Incidental Mutation 'R1382:Phactr1'
ID163105
Institutional Source Beutler Lab
Gene Symbol Phactr1
Ensembl Gene ENSMUSG00000054728
Gene Namephosphatase and actin regulator 1
SynonymsRpel1, 9630030F18Rik
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1382 (G1)
Quality Score195
Status Not validated
Chromosome13
Chromosomal Location42680623-43138526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43132975 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 584 (F584S)
Ref Sequence ENSEMBL: ENSMUSP00000115228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066928] [ENSMUST00000110161] [ENSMUST00000128646] [ENSMUST00000131942] [ENSMUST00000148891] [ENSMUST00000149235]
PDB Structure
Structure of the Phactr1 RPEL domain and RPEL motif directed assemblies with G-actin reveal the molecular basis for actin binding cooperativity. [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-N domain bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-2 domain bound to actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-2 bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-3 bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL domain bound to G-actin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000066928
AA Change: F515S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066663
Gene: ENSMUSG00000054728
AA Change: F515S

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 219 239 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
RPEL 415 440 1.23e-6 SMART
RPEL 453 478 5.14e-9 SMART
RPEL 491 516 2.71e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110161
AA Change: F591S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105790
Gene: ENSMUSG00000054728
AA Change: F591S

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 295 315 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
RPEL 491 516 1.23e-6 SMART
RPEL 529 554 5.14e-9 SMART
RPEL 567 592 2.71e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123987
Predicted Effect unknown
Transcript: ENSMUST00000128646
AA Change: F522S
SMART Domains Protein: ENSMUSP00000122232
Gene: ENSMUSG00000054728
AA Change: F522S

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131942
AA Change: F499S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123346
Gene: ENSMUSG00000054728
AA Change: F499S

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
RPEL 46 71 7.33e-5 SMART
low complexity region 85 103 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
low complexity region 203 223 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 372 383 N/A INTRINSIC
RPEL 399 424 1.23e-6 SMART
RPEL 437 462 5.14e-9 SMART
RPEL 475 500 2.71e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140651
Predicted Effect probably damaging
Transcript: ENSMUST00000148891
AA Change: F584S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115228
Gene: ENSMUSG00000054728
AA Change: F584S

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 216 225 N/A INTRINSIC
low complexity region 288 308 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
RPEL 484 509 1.23e-6 SMART
RPEL 522 547 5.14e-9 SMART
RPEL 560 585 2.71e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000149235
AA Change: F522S
SMART Domains Protein: ENSMUSP00000115207
Gene: ENSMUSG00000054728
AA Change: F522S

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161201
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphatase and actin regulator family of proteins. This family member can bind actin and regulate the reorganization of the actin cytoskeleton. It plays a role in tubule formation and in endothelial cell survival. Polymorphisms in this gene are associated with susceptibility to myocardial infarction, coronary artery disease and cervical artery dissection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Phactr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Phactr1 APN 13 42956646 missense probably damaging 0.99
IGL01144:Phactr1 APN 13 43037524 missense possibly damaging 0.93
IGL02193:Phactr1 APN 13 42709700 splice site probably benign
IGL02691:Phactr1 APN 13 43077737 missense probably benign 0.38
R0028:Phactr1 UTSW 13 43057179 missense probably damaging 1.00
R0060:Phactr1 UTSW 13 42682721 nonsense probably null
R0522:Phactr1 UTSW 13 43059591 missense probably benign 0.00
R1354:Phactr1 UTSW 13 43057331 missense possibly damaging 0.91
R1496:Phactr1 UTSW 13 43094990 missense probably damaging 0.98
R1620:Phactr1 UTSW 13 43094897 missense probably damaging 1.00
R1638:Phactr1 UTSW 13 42956671 missense probably damaging 1.00
R1679:Phactr1 UTSW 13 43057280 missense possibly damaging 0.65
R1679:Phactr1 UTSW 13 43094781 missense possibly damaging 0.94
R2055:Phactr1 UTSW 13 43077940 missense probably damaging 1.00
R2137:Phactr1 UTSW 13 43135175 missense possibly damaging 0.77
R2276:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R2279:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R3122:Phactr1 UTSW 13 43059573 missense possibly damaging 0.94
R4073:Phactr1 UTSW 13 43059769 intron probably benign
R4131:Phactr1 UTSW 13 43037477 missense probably damaging 0.99
R4237:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4238:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4239:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4240:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4507:Phactr1 UTSW 13 43096794 missense probably damaging 0.96
R4602:Phactr1 UTSW 13 43094965 missense probably benign 0.00
R4914:Phactr1 UTSW 13 43133963 missense possibly damaging 0.58
R5382:Phactr1 UTSW 13 43135219 utr 3 prime probably benign
R5882:Phactr1 UTSW 13 42709851 critical splice donor site probably null
R6253:Phactr1 UTSW 13 43094771 missense probably benign 0.06
R6451:Phactr1 UTSW 13 43132993 missense probably damaging 1.00
R6808:Phactr1 UTSW 13 43132969 missense probably damaging 1.00
R7061:Phactr1 UTSW 13 43132981 missense probably damaging 1.00
R7847:Phactr1 UTSW 13 43057188 missense possibly damaging 0.96
R7912:Phactr1 UTSW 13 42709763 missense probably benign 0.08
R7930:Phactr1 UTSW 13 43057188 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAGCTGGGCACTCTGGGTTCTAC -3'
(R):5'- TGGGAGGTTTTGCAACAGGTCAC -3'

Sequencing Primer
(F):5'- AACTCCATCTTGCTGTATAACACC -3'
(R):5'- TTGCAACAGGTCACCTGGATG -3'
Posted On2014-03-17