Incidental Mutation 'R1382:Arhgef6'
ID163118
Institutional Source Beutler Lab
Gene Symbol Arhgef6
Ensembl Gene ENSMUSG00000031133
Gene NameRac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Synonymsalpha-PIX, 1600028C08Rik, 1700038J06Rik, 4930592P22Rik
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1382 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location57231485-57338729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57338562 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 5 (M5V)
Ref Sequence ENSEMBL: ENSMUSP00000033468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033468]
Predicted Effect probably benign
Transcript: ENSMUST00000033468
AA Change: M5V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000033468
Gene: ENSMUSG00000031133
AA Change: M5V

DomainStartEndE-ValueType
CH 27 130 2.71e-21 SMART
Pfam:RhoGEF67_u1 138 183 4.4e-11 PFAM
SH3 186 241 7.33e-24 SMART
RhoGEF 268 443 1.04e-47 SMART
PH 473 573 1.02e-10 SMART
Pfam:RhoGEF67_u2 593 701 4e-65 PFAM
Pfam:betaPIX_CC 700 788 5.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135098
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein belongs to a family of cytoplasmic proteins that activate the Ras-like family of Rho proteins by exchanging bound GDP for GTP. It may form a complex with G proteins and stimulate Rho-dependent signals. This protein is activated by PI3-kinase. Mutations in this gene can cause X-chromosomal non-specific mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a truncated allele exhibit decreased mature lymphocyte cell numbers, decreased B and T cell proliferation, and defective humeral response. Mice homozygous for a reporter allele exhibit abnormal dendrite morphology and synaptic plasticity and cognitive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Arhgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Arhgef6 APN X 57245632 critical splice acceptor site probably null
IGL02049:Arhgef6 APN X 57275911 missense probably damaging 0.99
IGL02502:Arhgef6 APN X 57280263 missense probably damaging 1.00
IGL02584:Arhgef6 APN X 57246378 unclassified probably benign
IGL03038:Arhgef6 APN X 57245606 missense probably benign 0.00
IGL03294:Arhgef6 APN X 57336978 missense possibly damaging 0.52
R1385:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R1388:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R1432:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R1500:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R1503:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R1556:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R1749:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R1764:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R1767:Arhgef6 UTSW X 57338562 missense probably benign 0.01
R2010:Arhgef6 UTSW X 57299505 missense possibly damaging 0.95
R4928:Arhgef6 UTSW X 57234878 missense probably damaging 1.00
Z1177:Arhgef6 UTSW X 57304624 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCGAGGACTTCAAGAACTCCTCTG -3'
(R):5'- CACGAGCACTTGCTGACTTTTCTG -3'

Sequencing Primer
(F):5'- CTGGATCACAGACAGTCTTTTTG -3'
(R):5'- AGAACCAGTGATGTTCTCTCAGG -3'
Posted On2014-03-17