Incidental Mutation 'R1383:Olfr1259'
ID163123
Institutional Source Beutler Lab
Gene Symbol Olfr1259
Ensembl Gene ENSMUSG00000068806
Gene Nameolfactory receptor 1259
SynonymsGA_x6K02T2Q125-51376062-51375133, MOR232-9
MMRRC Submission 039445-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R1383 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89940532-89948664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89943551 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 188 (M188K)
Ref Sequence ENSEMBL: ENSMUSP00000149652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090695] [ENSMUST00000214846]
Predicted Effect probably benign
Transcript: ENSMUST00000090695
AA Change: M188K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088194
Gene: ENSMUSG00000068806
AA Change: M188K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 8.9e-45 PFAM
Pfam:7tm_1 39 285 5.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214846
AA Change: M188K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asph T A 4: 9,537,807 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eef1akmt1 A G 14: 57,558,032 probably null Het
Ext2 T C 2: 93,806,113 T219A possibly damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fat2 G A 11: 55,310,773 H492Y probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Kcmf1 A G 6: 72,849,582 F155L possibly damaging Het
Miox G A 15: 89,335,042 R29Q probably damaging Het
Mmrn1 A G 6: 60,976,322 Y529C probably damaging Het
Msmo1 G A 8: 64,723,645 T116I probably benign Het
Olfr1090 C T 2: 86,754,494 M81I possibly damaging Het
Olfr1107 A G 2: 87,071,792 L114P probably damaging Het
Olfr229 A T 9: 39,909,864 K20N probably benign Het
Ptpn6 A G 6: 124,721,893 I486T probably damaging Het
Slc12a8 T C 16: 33,534,987 F58L probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snrnp200 T C 2: 127,218,411 I525T probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Znrf3 G C 11: 5,281,994 F410L probably damaging Het
Other mutations in Olfr1259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1259 APN 2 89943260 missense probably damaging 0.96
IGL01446:Olfr1259 APN 2 89943938 missense probably damaging 0.99
IGL01830:Olfr1259 APN 2 89943431 missense probably benign 0.03
IGL02160:Olfr1259 APN 2 89943805 missense probably damaging 1.00
PIT4280001:Olfr1259 UTSW 2 89943743 missense probably damaging 1.00
R0366:Olfr1259 UTSW 2 89943818 missense possibly damaging 0.89
R0550:Olfr1259 UTSW 2 89943389 missense probably damaging 0.99
R0587:Olfr1259 UTSW 2 89943392 missense probably damaging 1.00
R1400:Olfr1259 UTSW 2 89943542 missense possibly damaging 0.82
R1851:Olfr1259 UTSW 2 89943814 nonsense probably null
R1953:Olfr1259 UTSW 2 89943923 missense probably damaging 1.00
R2330:Olfr1259 UTSW 2 89943953 missense probably benign
R3897:Olfr1259 UTSW 2 89943809 missense probably benign 0.24
R3955:Olfr1259 UTSW 2 89943828 missense possibly damaging 0.90
R4687:Olfr1259 UTSW 2 89943869 missense probably damaging 0.98
R4976:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5119:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5291:Olfr1259 UTSW 2 89943436 nonsense probably null
R5415:Olfr1259 UTSW 2 89943387 missense probably benign 0.25
R5546:Olfr1259 UTSW 2 89943585 missense probably damaging 1.00
R5588:Olfr1259 UTSW 2 89943792 missense probably benign 0.00
R6633:Olfr1259 UTSW 2 89943366 missense probably benign
R6858:Olfr1259 UTSW 2 89943743 missense probably damaging 0.99
R7294:Olfr1259 UTSW 2 89943724 nonsense probably null
R8261:Olfr1259 UTSW 2 89943372 missense probably benign 0.00
R8319:Olfr1259 UTSW 2 89943680 missense possibly damaging 0.87
Z1088:Olfr1259 UTSW 2 89943770 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACAGCAACACCTTTATCAAGTGGC -3'
(R):5'- GATTGCGGACTCCCTTCAAGAGAAC -3'

Sequencing Primer
(F):5'- CACCTTTATCAAGTGGCAAAGTGG -3'
(R):5'- ATTGACAGTGATGGCCTATGACC -3'
Posted On2014-03-17