Incidental Mutation 'R1383:Eef1akmt1'
ID163139
Institutional Source Beutler Lab
Gene Symbol Eef1akmt1
Ensembl Gene ENSMUSG00000021951
Gene NameEEF1A alpha lysine methyltransferase 1
SynonymsAyu21-96, N6amt2, Gt(Ayu21)96Imeg, GtAyu21-96, 2510005D08Rik
MMRRC Submission 039445-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1383 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57549597-57571612 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 57558032 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022518]
Predicted Effect probably null
Transcript: ENSMUST00000022518
SMART Domains Protein: ENSMUSP00000022518
Gene: ENSMUSG00000021951

DomainStartEndE-ValueType
Pfam:N6-adenineMlase 59 218 7.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225504
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asph T A 4: 9,537,807 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ext2 T C 2: 93,806,113 T219A possibly damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fat2 G A 11: 55,310,773 H492Y probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Kcmf1 A G 6: 72,849,582 F155L possibly damaging Het
Miox G A 15: 89,335,042 R29Q probably damaging Het
Mmrn1 A G 6: 60,976,322 Y529C probably damaging Het
Msmo1 G A 8: 64,723,645 T116I probably benign Het
Olfr1090 C T 2: 86,754,494 M81I possibly damaging Het
Olfr1107 A G 2: 87,071,792 L114P probably damaging Het
Olfr1259 A T 2: 89,943,551 M188K probably benign Het
Olfr229 A T 9: 39,909,864 K20N probably benign Het
Ptpn6 A G 6: 124,721,893 I486T probably damaging Het
Slc12a8 T C 16: 33,534,987 F58L probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snrnp200 T C 2: 127,218,411 I525T probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Znrf3 G C 11: 5,281,994 F410L probably damaging Het
Other mutations in Eef1akmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Eef1akmt1 APN 14 57549790 missense probably damaging 1.00
IGL02011:Eef1akmt1 APN 14 57558098 missense probably damaging 1.00
IGL02839:Eef1akmt1 APN 14 57549781 missense probably damaging 1.00
IGL03090:Eef1akmt1 APN 14 57558086 missense probably damaging 1.00
R1447:Eef1akmt1 UTSW 14 57565984 nonsense probably null
R1994:Eef1akmt1 UTSW 14 57550454 missense probably benign 0.02
R3026:Eef1akmt1 UTSW 14 57550434 missense probably damaging 1.00
R4582:Eef1akmt1 UTSW 14 57550448 missense probably damaging 1.00
R4921:Eef1akmt1 UTSW 14 57550632 missense probably damaging 0.97
R5071:Eef1akmt1 UTSW 14 57566007 missense probably damaging 1.00
R5073:Eef1akmt1 UTSW 14 57566007 missense probably damaging 1.00
R6112:Eef1akmt1 UTSW 14 57549873 missense possibly damaging 0.91
R7578:Eef1akmt1 UTSW 14 57549871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAACCGCATGACAACATTTAC -3'
(R):5'- ATATCAGCAGCCCTCGTACTCAGG -3'

Sequencing Primer
(F):5'- CCGCATGACAACATTTACATATTG -3'
(R):5'- TCGTACTCAGGGTGTAGCCTC -3'
Posted On2014-03-17