Mutagenetix > Incidental Mutations

Incidental Mutation 'R1384:Myoz2'

163153

Institutional Source

Beutler Lab

Gene Symbol

Myoz2

Ensembl Gene

ENSMUSG00000028116

Gene Name

myozenin 2

Synonyms

calsarcin-1, 1110012I24Rik, Fatz-2

MMRRC Submission

039446-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R1384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123006206-123035015 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123026116 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 65 (S65T)

Ref Sequence

ENSEMBL: ENSMUSP00000029761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029761] [ENSMUST00000141588]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029761
AA Change: S65T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029761
Gene: ENSMUSG00000028116
AA Change: S65T

Domain	Start	End	E-Value	Type
Pfam:Calsarcin	1	264	1.3e-89	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140231

Predicted Effect

probably benign
Transcript: ENSMUST00000141588

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200514

Meta Mutation Damage Score

0.1531

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants show an excess of skeletal muscle fibers and chronically activated hypertrophic gene program despite the absence of hypertrophy. However, stressed null mutants do form cardiac hypertrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930408O17Rik	G	A	12: 104,871,192		noncoding transcript	Het
A930033H14Rik	A	G	10: 69,212,361		probably benign	Het
Abcf3	G	A	16: 20,559,303	G522R	probably damaging	Het
Abi3bp	A	G	16: 56,574,499	Y190C	probably damaging	Het
Alg10b	A	G	15: 90,227,582	K210E	possibly damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
C9	G	A	15: 6,458,934	V90I	probably benign	Het
Cacna1s	A	G	1: 136,094,971	I634V	probably benign	Het
Catip	A	G	1: 74,364,363	D153G	probably benign	Het
Cpt1c	G	A	7: 44,960,924		probably benign	Het
Cyp2c23	A	G	19: 44,013,663	S296P	probably damaging	Het
Cyp2d41-ps	G	A	15: 82,779,517		noncoding transcript	Het
Edc4	T	A	8: 105,892,382	I1327N	probably damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Filip1l	A	G	16: 57,571,289	K509E	possibly damaging	Het
Golga4	A	G	9: 118,565,651	E96G	probably damaging	Het
Grid2ip	T	G	5: 143,386,096		probably null	Het
Gucy1a2	A	C	9: 3,759,620	E475D	probably damaging	Het
Hipk1	A	G	3: 103,758,774		probably benign	Het
Ica1	G	A	6: 8,742,262	Q124*	probably null	Het
Igsf3	T	C	3: 101,451,296		probably null	Het
Matn2	A	G	15: 34,409,810	E462G	probably benign	Het
Men1	T	C	19: 6,339,891	S464P	probably benign	Het
Mrgpra2b	T	A	7: 47,463,994	E330V	probably damaging	Het
Nckap1	A	G	2: 80,533,670	M492T	possibly damaging	Het
Nhsl1	A	T	10: 18,408,513	K67N	probably null	Het
Nostrin	A	G	2: 69,189,062	R484G	probably benign	Het
Olfr936	T	A	9: 39,046,904	I172F	possibly damaging	Het
Otog	T	A	7: 46,273,695		probably benign	Het
P2rx5	A	G	11: 73,167,890	Y300C	probably damaging	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pi4ka	A	G	16: 17,297,537		probably benign	Het
Pld3	A	G	7: 27,537,657	S266P	probably benign	Het
Pole	G	A	5: 110,323,664	V1425M	possibly damaging	Het
Prss43	A	G	9: 110,827,442	I66V	probably benign	Het
Rtn4	A	T	11: 29,736,437	N264I	probably damaging	Het
Slc45a2	A	G	15: 11,025,746	Y394C	probably benign	Het
Speer4f2	A	T	5: 17,374,449	N82I	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Strip1	T	C	3: 107,626,839	S160G	probably benign	Het
Tbx2	A	G	11: 85,833,492	K129R	probably benign	Het
Tfr2	T	C	5: 137,586,820		probably benign	Het
Thap12	T	C	7: 98,703,438	S17P	probably damaging	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tspear	T	C	10: 77,866,332	F200L	probably benign	Het
Tspyl5	T	A	15: 33,687,380	R140W	possibly damaging	Het
Ttn	T	C	2: 76,775,658	D18236G	probably damaging	Het
Upf2	G	A	2: 5,960,989	R140Q	unknown	Het
Vps4a	T	A	8: 107,036,644	I10N	possibly damaging	Het

Other mutations in Myoz2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Myoz2	APN	3	123016544	splice site	probably benign
IGL01417:Myoz2	APN	3	123006432	missense	possibly damaging	0.65
IGL01645:Myoz2	APN	3	123034232	missense	probably damaging	1.00
IGL01759:Myoz2	APN	3	123013781	missense	possibly damaging	0.95
IGL03167:Myoz2	APN	3	123006490	nonsense	probably null
R1789:Myoz2	UTSW	3	123026127	missense	probably damaging	1.00
R1874:Myoz2	UTSW	3	123026116	missense	probably damaging	1.00
R1875:Myoz2	UTSW	3	123026116	missense	probably damaging	1.00
R2137:Myoz2	UTSW	3	123034212	missense	probably benign	0.00
R3881:Myoz2	UTSW	3	123013720	missense	probably damaging	0.98
R6730:Myoz2	UTSW	3	123016627	missense	probably damaging	0.98
R8265:Myoz2	UTSW	3	123006523	missense	probably benign	0.15
R8548:Myoz2	UTSW	3	123034267	start codon destroyed	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- GCCAAATCTACGGCTCACAATGTCC -3'
(R):5'- TGACTGACTCAAGCACAAGCCAATG -3'

Sequencing Primer
(F):5'- GGCTCACAATGTCCTATTGAGAAG -3'
(R):5'- aagcacaagccaatgacttac -3'

Posted On

2014-03-17