Incidental Mutation 'R1384:Pars2'
ID163154
Institutional Source Beutler Lab
Gene Symbol Pars2
Ensembl Gene ENSMUSG00000043572
Gene Nameprolyl-tRNA synthetase (mitochondrial)(putative)
Synonyms
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106651069-106655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106653716 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 232 (F232L)
Ref Sequence ENSEMBL: ENSMUSP00000102393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058905] [ENSMUST00000106781] [ENSMUST00000106782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058905
AA Change: F196L

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053160
Gene: ENSMUSG00000043572
AA Change: F196L

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 98 268 4.8e-36 PFAM
Pfam:HGTP_anticodon 371 470 8.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106781
AA Change: F232L

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102393
Gene: ENSMUSG00000043572
AA Change: F232L

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 178 391 4.1e-36 PFAM
Pfam:HGTP_anticodon 407 506 3.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106782
SMART Domains Protein: ENSMUSP00000102394
Gene: ENSMUSG00000043572

DomainStartEndE-ValueType
PDB:2I4O|C 63 162 2e-8 PDB
SCOP:d1atia2 95 162 4e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146966
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of proline to tRNA molecules. Mutations have been found in this gene in some patients with Alpers syndrome. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Pars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pars2 APN 4 106654050 missense probably damaging 0.99
IGL03358:Pars2 APN 4 106653042 missense probably benign 0.00
PIT4378001:Pars2 UTSW 4 106654293 missense possibly damaging 0.51
R1874:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R1875:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R2041:Pars2 UTSW 4 106653617 missense probably damaging 1.00
R4606:Pars2 UTSW 4 106654050 missense probably benign 0.22
R4790:Pars2 UTSW 4 106651111 utr 5 prime probably benign
R4794:Pars2 UTSW 4 106654210 nonsense probably null
R5162:Pars2 UTSW 4 106654538 missense probably benign 0.00
R6066:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R6730:Pars2 UTSW 4 106653431 missense probably damaging 1.00
R6860:Pars2 UTSW 4 106654503 missense probably benign 0.45
R7710:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7712:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7817:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7870:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7953:Pars2 UTSW 4 106654079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCGGCGGGCAGAAAATCAAC -3'
(R):5'- CACTGGTAGCTGGAATTCATGGGAC -3'

Sequencing Primer
(F):5'- TGGGACCTGATGGGCAG -3'
(R):5'- AATTCATGGGACATCGTGCC -3'
Posted On2014-03-17