Incidental Mutation 'R1384:Tfr2'
ID163157
Institutional Source Beutler Lab
Gene Symbol Tfr2
Ensembl Gene ENSMUSG00000029716
Gene Nametransferrin receptor 2
SynonymsTrfr2, Tfr2
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137569840-137587481 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 137586820 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031729] [ENSMUST00000196471] [ENSMUST00000198783] [ENSMUST00000198866] [ENSMUST00000199054]
Predicted Effect probably benign
Transcript: ENSMUST00000031729
SMART Domains Protein: ENSMUSP00000031729
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 235 326 2.2e-12 PFAM
Pfam:Peptidase_M28 407 618 2.9e-16 PFAM
Pfam:TFR_dimer 664 788 5.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196450
Predicted Effect probably benign
Transcript: ENSMUST00000196471
SMART Domains Protein: ENSMUSP00000142814
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198783
SMART Domains Protein: ENSMUSP00000142502
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198866
SMART Domains Protein: ENSMUSP00000142720
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199054
SMART Domains Protein: ENSMUSP00000142478
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199069
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein, which is a member of the transferrin receptor-like family. This protein mediates cellular uptake of transferrin-bound iron, and may be involved in iron metabolism, hepatocyte function and erythrocyte differentiation. Mutations in this gene have been associated with hereditary hemochromatosis type III. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutant mice exhibit iron homeostasis defects similar to those observed in human hemachromatosis. On a standard diet, mutant mice show periportal hepatic iron loading, splenic iron sparing, and elevated serum transferrin saturations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Tfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tfr2 APN 5 137574455 missense probably null
IGL00960:Tfr2 APN 5 137571692 missense probably benign 0.00
IGL01360:Tfr2 APN 5 137571691 missense probably benign
IGL02967:Tfr2 APN 5 137582819 nonsense probably null
IGL02996:Tfr2 APN 5 137583466 missense probably benign
IGL03278:Tfr2 APN 5 137571036 nonsense probably null
iron-man UTSW 5 137583153 splice site probably benign
R0114:Tfr2 UTSW 5 137577465 missense probably benign 0.00
R1525:Tfr2 UTSW 5 137579030 missense probably benign 0.00
R1545:Tfr2 UTSW 5 137583299 missense probably benign 0.03
R1765:Tfr2 UTSW 5 137583445 missense probably damaging 0.98
R1908:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R1943:Tfr2 UTSW 5 137578921 missense probably benign
R3439:Tfr2 UTSW 5 137574651 missense probably benign 0.03
R4332:Tfr2 UTSW 5 137571734 missense probably damaging 1.00
R4626:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R4915:Tfr2 UTSW 5 137583411 missense probably damaging 0.96
R4999:Tfr2 UTSW 5 137586925 missense probably benign 0.00
R5150:Tfr2 UTSW 5 137574490 missense probably benign 0.22
R5200:Tfr2 UTSW 5 137570980 splice site probably benign
R5936:Tfr2 UTSW 5 137587006 missense probably benign 0.00
R6165:Tfr2 UTSW 5 137580257 missense probably damaging 0.97
R6513:Tfr2 UTSW 5 137574531 splice site probably null
R7076:Tfr2 UTSW 5 137583574 missense probably damaging 1.00
R7115:Tfr2 UTSW 5 137571715 missense probably benign
R7524:Tfr2 UTSW 5 137571489 nonsense probably null
R7524:Tfr2 UTSW 5 137583489 missense probably benign 0.12
R7799:Tfr2 UTSW 5 137571724 missense possibly damaging 0.69
X0067:Tfr2 UTSW 5 137577548 missense probably benign 0.01
Z1176:Tfr2 UTSW 5 137571737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGGATTAGAACCCTGGCTCC -3'
(R):5'- GTCAATGTTCCAAACGTCGCCAC -3'

Sequencing Primer
(F):5'- GATTAGAACCCTGGCTCCTGATG -3'
(R):5'- GAAGCGACTCTCCTGGAAG -3'
Posted On2014-03-17