Incidental Mutation 'R1384:Cpt1c'
Institutional Source Beutler Lab
Gene Symbol Cpt1c
Ensembl Gene ENSMUSG00000007783
Gene Namecarnitine palmitoyltransferase 1c
Synonyms9630004I06Rik, CPT I-C
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosomal Location44959372-44974851 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 44960924 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063761] [ENSMUST00000080233] [ENSMUST00000120929] [ENSMUST00000212836]
Predicted Effect probably benign
Transcript: ENSMUST00000063761
SMART Domains Protein: ENSMUSP00000069539
Gene: ENSMUSG00000007783

Pfam:CPT_N 1 47 2.3e-21 PFAM
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 757 7.7e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080233
SMART Domains Protein: ENSMUSP00000079122
Gene: ENSMUSG00000059891

Pfam:TSKS 26 525 5.7e-281 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120929
SMART Domains Protein: ENSMUSP00000112673
Gene: ENSMUSG00000059891

Pfam:TSKS 26 585 8.1e-297 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212217
Predicted Effect probably benign
Transcript: ENSMUST00000212836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212890
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein regulates the beta-oxidation and transport of long-chain fatty acids into mitochondria, and may play a role in the regulation of feeding behavior and whole-body energy homeostasis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted mutations in this gene result in reduced body weight, increases in circulating fatty acid levels and mild insulin resistance. Mice homozygous for a different targeted knock-out exhibit reduced ceramide levels, impaired dendritic spine maturationand impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
C9 G A 15: 6,458,934 V90I probably benign Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in Cpt1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Cpt1c APN 7 44960909 missense probably damaging 0.98
IGL01111:Cpt1c APN 7 44965554 missense possibly damaging 0.90
IGL01153:Cpt1c APN 7 44966668 missense probably damaging 0.99
IGL02232:Cpt1c APN 7 44960156 missense probably damaging 0.99
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0141:Cpt1c UTSW 7 44966671 missense probably damaging 1.00
R0367:Cpt1c UTSW 7 44959575 missense probably benign
R0749:Cpt1c UTSW 7 44962826 missense probably damaging 1.00
R1611:Cpt1c UTSW 7 44960112 missense probably benign 0.03
R3122:Cpt1c UTSW 7 44959921 missense probably damaging 1.00
R4892:Cpt1c UTSW 7 44959588 missense probably benign 0.14
R5175:Cpt1c UTSW 7 44971357 missense probably damaging 1.00
R6029:Cpt1c UTSW 7 44965124 missense probably benign 0.00
R6352:Cpt1c UTSW 7 44966795 critical splice donor site probably null
R6856:Cpt1c UTSW 7 44959918 missense probably damaging 1.00
R7621:Cpt1c UTSW 7 44967092 missense probably damaging 1.00
R7749:Cpt1c UTSW 7 44962265 missense probably benign 0.16
R7966:Cpt1c UTSW 7 44964014 splice site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcattccttgctgtgtgacc -3'
Posted On2014-03-17