Mutagenetix > Incidental Mutations

Incidental Mutation 'R1384:Thap12'

163165

Institutional Source

Beutler Lab

Gene Symbol

Thap12

Ensembl Gene

ENSMUSG00000030753

Gene Name

THAP domain containing 12

Synonyms

Prkrir, Dap4, 2900052B10Rik

MMRRC Submission

039446-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R1384 (G1)

Quality Score

125

Status

Validated

Chromosome

Chromosomal Location

98703103-98718062 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98703438 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 17 (S17P)

Ref Sequence

ENSEMBL: ENSMUSP00000033009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]

AlphaFold

Q9CUX1

Predicted Effect

probably damaging
Transcript: ENSMUST00000033009
AA Change: S17P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: S17P

Domain	Start	End	E-Value	Type
THAP	3	92	8.38e-22	SMART
DM3	21	91	1.49e-20	SMART
Pfam:DUF4371	112	338	1.9e-22	PFAM
low complexity region	433	445	N/A	INTRINSIC
Pfam:Dimer_Tnp_hAT	631	726	6.9e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126356
AA Change: S17P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753
AA Change: S17P

Domain	Start	End	E-Value	Type
THAP	3	78	3.21e-9	SMART
DM3	21	78	1.89e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148776

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153566
AA Change: S17P

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753
AA Change: S17P

Domain	Start	End	E-Value	Type
THAP	3	92	8.38e-22	SMART
DM3	21	91	1.49e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208646

Meta Mutation Damage Score

0.1976

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

96% (54/56)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930408O17Rik	G	A	12: 104,871,192		noncoding transcript	Het
A930033H14Rik	A	G	10: 69,212,361		probably benign	Het
Abcf3	G	A	16: 20,559,303	G522R	probably damaging	Het
Abi3bp	A	G	16: 56,574,499	Y190C	probably damaging	Het
Alg10b	A	G	15: 90,227,582	K210E	possibly damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
C9	G	A	15: 6,458,934	V90I	probably benign	Het
Cacna1s	A	G	1: 136,094,971	I634V	probably benign	Het
Catip	A	G	1: 74,364,363	D153G	probably benign	Het
Cpt1c	G	A	7: 44,960,924		probably benign	Het
Cyp2c23	A	G	19: 44,013,663	S296P	probably damaging	Het
Cyp2d41-ps	G	A	15: 82,779,517		noncoding transcript	Het
Edc4	T	A	8: 105,892,382	I1327N	probably damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Filip1l	A	G	16: 57,571,289	K509E	possibly damaging	Het
Golga4	A	G	9: 118,565,651	E96G	probably damaging	Het
Grid2ip	T	G	5: 143,386,096		probably null	Het
Gucy1a2	A	C	9: 3,759,620	E475D	probably damaging	Het
Hipk1	A	G	3: 103,758,774		probably benign	Het
Ica1	G	A	6: 8,742,262	Q124*	probably null	Het
Igsf3	T	C	3: 101,451,296		probably null	Het
Matn2	A	G	15: 34,409,810	E462G	probably benign	Het
Men1	T	C	19: 6,339,891	S464P	probably benign	Het
Mrgpra2b	T	A	7: 47,463,994	E330V	probably damaging	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Nckap1	A	G	2: 80,533,670	M492T	possibly damaging	Het
Nhsl1	A	T	10: 18,408,513	K67N	probably null	Het
Nostrin	A	G	2: 69,189,062	R484G	probably benign	Het
Olfr936	T	A	9: 39,046,904	I172F	possibly damaging	Het
Otog	T	A	7: 46,273,695		probably benign	Het
P2rx5	A	G	11: 73,167,890	Y300C	probably damaging	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pi4ka	A	G	16: 17,297,537		probably benign	Het
Pld3	A	G	7: 27,537,657	S266P	probably benign	Het
Pole	G	A	5: 110,323,664	V1425M	possibly damaging	Het
Prss43	A	G	9: 110,827,442	I66V	probably benign	Het
Rtn4	A	T	11: 29,736,437	N264I	probably damaging	Het
Slc45a2	A	G	15: 11,025,746	Y394C	probably benign	Het
Speer4f2	A	T	5: 17,374,449	N82I	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Strip1	T	C	3: 107,626,839	S160G	probably benign	Het
Tbx2	A	G	11: 85,833,492	K129R	probably benign	Het
Tfr2	T	C	5: 137,586,820		probably benign	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tspear	T	C	10: 77,866,332	F200L	probably benign	Het
Tspyl5	T	A	15: 33,687,380	R140W	possibly damaging	Het
Ttn	T	C	2: 76,775,658	D18236G	probably damaging	Het
Upf2	G	A	2: 5,960,989	R140Q	unknown	Het
Vps4a	T	A	8: 107,036,644	I10N	possibly damaging	Het

Other mutations in Thap12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Thap12	APN	7	98716137	missense	possibly damaging	0.82
IGL01145:Thap12	APN	7	98712903	makesense	probably null
IGL01973:Thap12	APN	7	98716499	missense	possibly damaging	0.58
IGL02404:Thap12	APN	7	98710133	missense	probably damaging	1.00
H8562:Thap12	UTSW	7	98715107	missense	probably damaging	0.98
PIT4453001:Thap12	UTSW	7	98715038	missense	probably benign	0.00
R0090:Thap12	UTSW	7	98715893	missense	probably damaging	1.00
R0254:Thap12	UTSW	7	98715281	missense	probably benign	0.03
R1344:Thap12	UTSW	7	98716830	missense	probably damaging	0.97
R1418:Thap12	UTSW	7	98716830	missense	probably damaging	0.97
R1448:Thap12	UTSW	7	98716023	missense	probably benign	0.01
R1493:Thap12	UTSW	7	98715438	missense	probably benign	0.30
R1906:Thap12	UTSW	7	98716740	missense	probably damaging	1.00
R1932:Thap12	UTSW	7	98716838	missense	possibly damaging	0.77
R1992:Thap12	UTSW	7	98716365	missense	possibly damaging	0.68
R2044:Thap12	UTSW	7	98716620	missense	probably damaging	1.00
R2092:Thap12	UTSW	7	98716449	missense	possibly damaging	0.70
R2160:Thap12	UTSW	7	98710126	missense	probably damaging	0.97
R3850:Thap12	UTSW	7	98716663	missense	probably damaging	1.00
R4086:Thap12	UTSW	7	98716494	missense	possibly damaging	0.94
R4162:Thap12	UTSW	7	98710078	intron	probably benign
R4554:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4555:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4556:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4557:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4659:Thap12	UTSW	7	98710091	intron	probably benign
R4734:Thap12	UTSW	7	98715954	missense	probably damaging	0.98
R4734:Thap12	UTSW	7	98715955	nonsense	probably null
R5794:Thap12	UTSW	7	98716393	missense	probably benign	0.11
R5994:Thap12	UTSW	7	98716030	nonsense	probably null
R6298:Thap12	UTSW	7	98703405	missense	probably damaging	1.00
R6515:Thap12	UTSW	7	98707095	missense	probably damaging	0.97
R6624:Thap12	UTSW	7	98715586	nonsense	probably null
R6625:Thap12	UTSW	7	98716070	missense	probably benign	0.00
R6965:Thap12	UTSW	7	98715462	missense	probably damaging	1.00
R7560:Thap12	UTSW	7	98710231	missense	probably damaging	0.99
R8713:Thap12	UTSW	7	98707076	missense	probably benign	0.30
R8897:Thap12	UTSW	7	98715327	missense	probably benign	0.38
R9099:Thap12	UTSW	7	98715393	missense	probably damaging	1.00
R9260:Thap12	UTSW	7	98707073	nonsense	probably null
R9339:Thap12	UTSW	7	98715116	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CGTGAAGTAACGTTCTAGCTTGCCC -3'
(R):5'- TTGACAGCTAAGGAACCGCGTC -3'

Sequencing Primer
(F):5'- TGCATTGAGACTACGCAGC -3'
(R):5'- GCGTCGGACCACCAAAG -3'

Posted On

2014-03-17