Mutagenetix > Incidental Mutation

Incidental Mutation 'R1384:Golga4'

163171

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

039446-MU

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1384 (G1)

Quality Score

177

Status

Validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118565651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 96 (E96G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000211846]

AlphaFold

Q91VW5

Predicted Effect

probably benign
Transcript: ENSMUST00000084820
AA Change: E2107G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: E2107G

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000211840
AA Change: E1117G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211846
AA Change: E7G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212151

Predicted Effect

probably damaging
Transcript: ENSMUST00000212274
AA Change: E96G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Meta Mutation Damage Score

0.0678

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930408O17Rik	G	A	12: 104,871,192		noncoding transcript	Het
A930033H14Rik	A	G	10: 69,212,361		probably benign	Het
Abcf3	G	A	16: 20,559,303	G522R	probably damaging	Het
Abi3bp	A	G	16: 56,574,499	Y190C	probably damaging	Het
Alg10b	A	G	15: 90,227,582	K210E	possibly damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
C9	G	A	15: 6,458,934	V90I	probably benign	Het
Cacna1s	A	G	1: 136,094,971	I634V	probably benign	Het
Catip	A	G	1: 74,364,363	D153G	probably benign	Het
Cpt1c	G	A	7: 44,960,924		probably benign	Het
Cyp2c23	A	G	19: 44,013,663	S296P	probably damaging	Het
Cyp2d41-ps	G	A	15: 82,779,517		noncoding transcript	Het
Edc4	T	A	8: 105,892,382	I1327N	probably damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Filip1l	A	G	16: 57,571,289	K509E	possibly damaging	Het
Grid2ip	T	G	5: 143,386,096		probably null	Het
Gucy1a2	A	C	9: 3,759,620	E475D	probably damaging	Het
Hipk1	A	G	3: 103,758,774		probably benign	Het
Ica1	G	A	6: 8,742,262	Q124*	probably null	Het
Igsf3	T	C	3: 101,451,296		probably null	Het
Matn2	A	G	15: 34,409,810	E462G	probably benign	Het
Men1	T	C	19: 6,339,891	S464P	probably benign	Het
Mrgpra2b	T	A	7: 47,463,994	E330V	probably damaging	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Nckap1	A	G	2: 80,533,670	M492T	possibly damaging	Het
Nhsl1	A	T	10: 18,408,513	K67N	probably null	Het
Nostrin	A	G	2: 69,189,062	R484G	probably benign	Het
Olfr936	T	A	9: 39,046,904	I172F	possibly damaging	Het
Otog	T	A	7: 46,273,695		probably benign	Het
P2rx5	A	G	11: 73,167,890	Y300C	probably damaging	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pi4ka	A	G	16: 17,297,537		probably benign	Het
Pld3	A	G	7: 27,537,657	S266P	probably benign	Het
Pole	G	A	5: 110,323,664	V1425M	possibly damaging	Het
Prss43	A	G	9: 110,827,442	I66V	probably benign	Het
Rtn4	A	T	11: 29,736,437	N264I	probably damaging	Het
Slc45a2	A	G	15: 11,025,746	Y394C	probably benign	Het
Speer4f2	A	T	5: 17,374,449	N82I	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Strip1	T	C	3: 107,626,839	S160G	probably benign	Het
Tbx2	A	G	11: 85,833,492	K129R	probably benign	Het
Tfr2	T	C	5: 137,586,820		probably benign	Het
Thap12	T	C	7: 98,703,438	S17P	probably damaging	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tspear	T	C	10: 77,866,332	F200L	probably benign	Het
Tspyl5	T	A	15: 33,687,380	R140W	possibly damaging	Het
Ttn	T	C	2: 76,775,658	D18236G	probably damaging	Het
Upf2	G	A	2: 5,960,989	R140Q	unknown	Het
Vps4a	T	A	8: 107,036,644	I10N	possibly damaging	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AAGGAGTGACGAGTTCTGTGTCCC -3'
(R):5'- TGCAGCCCTCAGTGACTGATAACC -3'

Sequencing Primer
(F):5'- CTGTTTTCATGCTGAAGGCC -3'
(R):5'- CCTCAGTGACTGATAACCTGTAAG -3'

Posted On

2014-03-17