Incidental Mutation 'R1384:C9'
ID163180
Institutional Source Beutler Lab
Gene Symbol C9
Ensembl Gene ENSMUSG00000022149
Gene Namecomplement component 9
Synonyms
MMRRC Submission 039446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1384 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6445327-6498751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6458934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 90 (V90I)
Ref Sequence ENSEMBL: ENSMUSP00000022749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022749]
Predicted Effect probably benign
Transcript: ENSMUST00000022749
AA Change: V90I

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022749
Gene: ENSMUSG00000022149
AA Change: V90I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
TSP1 56 106 1.8e-6 SMART
LDLa 111 147 2.7e-12 SMART
MACPF 304 519 2.9e-52 SMART
Blast:EGF 525 556 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128097
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930408O17Rik G A 12: 104,871,192 noncoding transcript Het
A930033H14Rik A G 10: 69,212,361 probably benign Het
Abcf3 G A 16: 20,559,303 G522R probably damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Alg10b A G 15: 90,227,582 K210E possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1s A G 1: 136,094,971 I634V probably benign Het
Catip A G 1: 74,364,363 D153G probably benign Het
Cpt1c G A 7: 44,960,924 probably benign Het
Cyp2c23 A G 19: 44,013,663 S296P probably damaging Het
Cyp2d41-ps G A 15: 82,779,517 noncoding transcript Het
Edc4 T A 8: 105,892,382 I1327N probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Filip1l A G 16: 57,571,289 K509E possibly damaging Het
Golga4 A G 9: 118,565,651 E96G probably damaging Het
Grid2ip T G 5: 143,386,096 probably null Het
Gucy1a2 A C 9: 3,759,620 E475D probably damaging Het
Hipk1 A G 3: 103,758,774 probably benign Het
Ica1 G A 6: 8,742,262 Q124* probably null Het
Igsf3 T C 3: 101,451,296 probably null Het
Matn2 A G 15: 34,409,810 E462G probably benign Het
Men1 T C 19: 6,339,891 S464P probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Nckap1 A G 2: 80,533,670 M492T possibly damaging Het
Nhsl1 A T 10: 18,408,513 K67N probably null Het
Nostrin A G 2: 69,189,062 R484G probably benign Het
Olfr936 T A 9: 39,046,904 I172F possibly damaging Het
Otog T A 7: 46,273,695 probably benign Het
P2rx5 A G 11: 73,167,890 Y300C probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pi4ka A G 16: 17,297,537 probably benign Het
Pld3 A G 7: 27,537,657 S266P probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Prss43 A G 9: 110,827,442 I66V probably benign Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Slc45a2 A G 15: 11,025,746 Y394C probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Strip1 T C 3: 107,626,839 S160G probably benign Het
Tbx2 A G 11: 85,833,492 K129R probably benign Het
Tfr2 T C 5: 137,586,820 probably benign Het
Thap12 T C 7: 98,703,438 S17P probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tspear T C 10: 77,866,332 F200L probably benign Het
Tspyl5 T A 15: 33,687,380 R140W possibly damaging Het
Ttn T C 2: 76,775,658 D18236G probably damaging Het
Upf2 G A 2: 5,960,989 R140Q unknown Het
Vps4a T A 8: 107,036,644 I10N possibly damaging Het
Other mutations in C9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:C9 APN 15 6486656 missense probably benign 0.04
IGL00229:C9 APN 15 6483231 missense possibly damaging 0.68
IGL00647:C9 APN 15 6483083 missense probably benign 0.43
IGL01618:C9 APN 15 6459668 missense probably benign 0.38
IGL02530:C9 APN 15 6497132 missense probably benign
R0267:C9 UTSW 15 6467458 missense probably benign 0.00
R0477:C9 UTSW 15 6458183 missense probably benign 0.25
R0552:C9 UTSW 15 6445437 missense probably damaging 0.98
R0701:C9 UTSW 15 6467421 missense probably damaging 1.00
R0792:C9 UTSW 15 6486762 missense probably damaging 1.00
R0881:C9 UTSW 15 6458868 splice site probably benign
R1281:C9 UTSW 15 6489840 missense possibly damaging 0.80
R1522:C9 UTSW 15 6486762 missense probably damaging 1.00
R1988:C9 UTSW 15 6483138 frame shift probably null
R2229:C9 UTSW 15 6445420 missense possibly damaging 0.95
R2406:C9 UTSW 15 6483299 missense possibly damaging 0.76
R3720:C9 UTSW 15 6483119 missense possibly damaging 0.95
R3723:C9 UTSW 15 6483080 missense possibly damaging 0.77
R3929:C9 UTSW 15 6467458 missense probably benign 0.00
R4371:C9 UTSW 15 6491484 missense probably damaging 1.00
R4615:C9 UTSW 15 6491463 missense probably damaging 0.99
R4616:C9 UTSW 15 6491463 missense probably damaging 0.99
R4618:C9 UTSW 15 6491463 missense probably damaging 0.99
R4749:C9 UTSW 15 6489830 missense probably benign 0.19
R4764:C9 UTSW 15 6459643 missense probably damaging 1.00
R5544:C9 UTSW 15 6497027 missense probably damaging 0.99
R5723:C9 UTSW 15 6486816 missense probably damaging 1.00
R5813:C9 UTSW 15 6497126 missense probably benign 0.05
R6735:C9 UTSW 15 6489906 missense probably benign 0.06
R6754:C9 UTSW 15 6489943 nonsense probably null
R6956:C9 UTSW 15 6445464 missense probably benign
R7706:C9 UTSW 15 6458921 missense probably benign 0.08
R7791:C9 UTSW 15 6489878 missense possibly damaging 0.82
R7893:C9 UTSW 15 6483245 missense possibly damaging 0.94
R7976:C9 UTSW 15 6483245 missense possibly damaging 0.94
Z1177:C9 UTSW 15 6491519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTGCATGTTGAACAGCAGAC -3'
(R):5'- AGCCCTTGTTGAGGAGCCATTG -3'

Sequencing Primer
(F):5'- tcacctgagaccatcagaaaac -3'
(R):5'- AGGAGCCATTGCACTTGG -3'
Posted On2014-03-17