Mutagenetix > Incidental Mutations

Incidental Mutation 'R1384:Filip1l'

163189

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

MMRRC Submission

039446-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57571289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 509 (K509E)

Ref Sequence

ENSEMBL: ENSMUSP00000124069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159414
AA Change: K509E

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: K509E

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159816
AA Change: K747E

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: K747E

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231282

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Meta Mutation Damage Score

0.1614

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

96% (54/56)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930408O17Rik	G	A	12: 104,871,192		noncoding transcript	Het
A930033H14Rik	A	G	10: 69,212,361		probably benign	Het
Abcf3	G	A	16: 20,559,303	G522R	probably damaging	Het
Abi3bp	A	G	16: 56,574,499	Y190C	probably damaging	Het
Alg10b	A	G	15: 90,227,582	K210E	possibly damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
C9	G	A	15: 6,458,934	V90I	probably benign	Het
Cacna1s	A	G	1: 136,094,971	I634V	probably benign	Het
Catip	A	G	1: 74,364,363	D153G	probably benign	Het
Cpt1c	G	A	7: 44,960,924		probably benign	Het
Cyp2c23	A	G	19: 44,013,663	S296P	probably damaging	Het
Cyp2d41-ps	G	A	15: 82,779,517		noncoding transcript	Het
Edc4	T	A	8: 105,892,382	I1327N	probably damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Golga4	A	G	9: 118,565,651	E96G	probably damaging	Het
Grid2ip	T	G	5: 143,386,096		probably null	Het
Gucy1a2	A	C	9: 3,759,620	E475D	probably damaging	Het
Hipk1	A	G	3: 103,758,774		probably benign	Het
Ica1	G	A	6: 8,742,262	Q124*	probably null	Het
Igsf3	T	C	3: 101,451,296		probably null	Het
Matn2	A	G	15: 34,409,810	E462G	probably benign	Het
Men1	T	C	19: 6,339,891	S464P	probably benign	Het
Mrgpra2b	T	A	7: 47,463,994	E330V	probably damaging	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Nckap1	A	G	2: 80,533,670	M492T	possibly damaging	Het
Nhsl1	A	T	10: 18,408,513	K67N	probably null	Het
Nostrin	A	G	2: 69,189,062	R484G	probably benign	Het
Olfr936	T	A	9: 39,046,904	I172F	possibly damaging	Het
Otog	T	A	7: 46,273,695		probably benign	Het
P2rx5	A	G	11: 73,167,890	Y300C	probably damaging	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pi4ka	A	G	16: 17,297,537		probably benign	Het
Pld3	A	G	7: 27,537,657	S266P	probably benign	Het
Pole	G	A	5: 110,323,664	V1425M	possibly damaging	Het
Prss43	A	G	9: 110,827,442	I66V	probably benign	Het
Rtn4	A	T	11: 29,736,437	N264I	probably damaging	Het
Slc45a2	A	G	15: 11,025,746	Y394C	probably benign	Het
Speer4f2	A	T	5: 17,374,449	N82I	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Strip1	T	C	3: 107,626,839	S160G	probably benign	Het
Tbx2	A	G	11: 85,833,492	K129R	probably benign	Het
Tfr2	T	C	5: 137,586,820		probably benign	Het
Thap12	T	C	7: 98,703,438	S17P	probably damaging	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tspear	T	C	10: 77,866,332	F200L	probably benign	Het
Tspyl5	T	A	15: 33,687,380	R140W	possibly damaging	Het
Ttn	T	C	2: 76,775,658	D18236G	probably damaging	Het
Upf2	G	A	2: 5,960,989	R140Q	unknown	Het
Vps4a	T	A	8: 107,036,644	I10N	possibly damaging	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R7950:Filip1l	UTSW	16	57569711	missense	probably damaging	1.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
R8742:Filip1l	UTSW	16	57571230	missense	probably damaging	1.00
R9020:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R9157:Filip1l	UTSW	16	57571617	missense	probably benign	0.04
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGCCAAGATGGAGCTTGCC -3'
(R):5'- TGCATCTGAAGGACAGCACAGAC -3'

Sequencing Primer
(F):5'- GAGCTTGCCAAGTACAAGTTG -3'
(R):5'- ACTGCTCTTTCCAGAGGAATGAG -3'

Posted On

2014-03-17