Incidental Mutation 'R1385:Scn9a'
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Namesodium channel, voltage-gated, type IX, alpha
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1385 (G1)
Quality Score225
Status Not validated
Chromosomal Location66480080-66634962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66563542 bp
Amino Acid Change Proline to Leucine at position 229 (P229L)
Ref Sequence ENSEMBL: ENSMUSP00000097641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
Predicted Effect probably damaging
Transcript: ENSMUST00000100063
AA Change: P229L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: P229L

low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100064
AA Change: P229L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: P229L

low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112354
AA Change: P229L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: P229L

low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141603
Predicted Effect probably damaging
Transcript: ENSMUST00000164384
AA Change: P229L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: P229L

low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169900
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316

low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
BB007:Scn9a UTSW 2 66504849 missense probably damaging 0.99
BB017:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0718:Scn9a UTSW 2 66547112 missense probably damaging 1.00
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1517:Scn9a UTSW 2 66505027 splice site probably benign
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1634:Scn9a UTSW 2 66488017 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1741:Scn9a UTSW 2 66487594 missense probably damaging 0.99
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2114:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
R7102:Scn9a UTSW 2 66549015 missense probably damaging 1.00
R7186:Scn9a UTSW 2 66534223 missense probably damaging 1.00
R7243:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R7311:Scn9a UTSW 2 66484404 missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66484587 missense probably benign
R7386:Scn9a UTSW 2 66540550 missense probably damaging 1.00
R7438:Scn9a UTSW 2 66547187 missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66533348 missense probably damaging 0.99
R7485:Scn9a UTSW 2 66534217 missense probably damaging 1.00
R7526:Scn9a UTSW 2 66483646 missense probably benign
R7617:Scn9a UTSW 2 66540549 missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66536236 missense probably benign 0.02
R7653:Scn9a UTSW 2 66527080 missense probably damaging 1.00
R7747:Scn9a UTSW 2 66484298 missense probably damaging 1.00
R7823:Scn9a UTSW 2 66483791 missense probably damaging 1.00
R7864:Scn9a UTSW 2 66484560 missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66543112 missense probably benign 0.00
R7930:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R7975:Scn9a UTSW 2 66484253 missense probably damaging 1.00
R8057:Scn9a UTSW 2 66515430 missense probably benign 0.06
R8145:Scn9a UTSW 2 66487410 missense probably damaging 1.00
R8163:Scn9a UTSW 2 66484401 missense probably damaging 1.00
R8165:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R8342:Scn9a UTSW 2 66536282 missense probably benign
R8345:Scn9a UTSW 2 66494622 missense probably damaging 0.96
R8464:Scn9a UTSW 2 66566281 missense probably damaging 0.99
R8467:Scn9a UTSW 2 66501671 missense probably damaging 1.00
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66540592 missense probably benign 0.00
Z1177:Scn9a UTSW 2 66494685 missense possibly damaging 0.68
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- actcactccaagaagaaaccc -3'
Posted On2014-03-17