Mutagenetix > Incidental Mutations

Incidental Mutation 'R1385:Xpo1'

163225

Institutional Source

Beutler Lab

Gene Symbol

Xpo1

Ensembl Gene

ENSMUSG00000020290

Gene Name

exportin 1

Synonyms

Crm1

MMRRC Submission

039447-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1385 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23256041-23298249 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23261863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 8 (L8S)

Ref Sequence

ENSEMBL: ENSMUSP00000123634 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551] [ENSMUST00000136235]

AlphaFold

Q6P5F9

Predicted Effect

probably benign
Transcript: ENSMUST00000020538
AA Change: L8S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: L8S

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102869
AA Change: L8S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: L8S

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	7.4e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102870
AA Change: L8S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: L8S

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109551
AA Change: L8S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: L8S

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000136235
AA Change: L8S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123634
Gene: ENSMUSG00000020290
AA Change: L8S

Domain	Start	End	E-Value	Type
PDB:4BSN\|A	1	59	4e-35	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149371

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	9: 58,499,432		probably benign	Het
Aldh7a1	A	G	18: 56,542,285	S269P	probably damaging	Het
Arf3	A	G	15: 98,742,613	V43A	probably damaging	Het
Arhgap1	C	A	2: 91,670,831	N457K	probably damaging	Het
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Ccdc39	C	T	3: 33,821,412	E544K	probably damaging	Het
Cfap44	A	G	16: 44,470,775	E1546G	probably damaging	Het
Cntn6	A	G	6: 104,861,900	I900V	probably benign	Het
Edem1	A	G	6: 108,846,684	N347S	probably damaging	Het
Erich6	A	G	3: 58,636,830	I112T	probably benign	Het
Gemin2	A	G	12: 59,018,146		probably null	Het
Gm44	T	A	X: 90,892,268	C43S	probably benign	Het
Hunk	T	A	16: 90,472,486	V306E	possibly damaging	Het
Hydin	A	G	8: 110,523,204	I2260V	probably benign	Het
Itgbl1	A	G	14: 123,661,511		probably null	Het
Iws1	T	A	18: 32,090,430	N630K	probably benign	Het
Lama2	C	A	10: 27,224,043	R822L	probably benign	Het
Lrrc56	A	G	7: 141,205,525	D130G	probably damaging	Het
Malrd1	A	T	2: 16,042,228	I1722F	unknown	Het
Mark4	G	T	7: 19,426,027		probably null	Het
Muc5b	T	C	7: 141,862,137	V2940A	probably benign	Het
Mxd1	T	A	6: 86,651,567	Q62L	probably damaging	Het
Ncapd2	A	T	6: 125,173,115	S917T	probably benign	Het
Nr2c2	T	G	6: 92,154,470	F171C	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Nynrin	A	T	14: 55,864,899	Q675L	probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Ocstamp	T	C	2: 165,396,039	D435G	probably benign	Het
Pdzd2	T	C	15: 12,411,022	T553A	probably benign	Het
Pllp	A	G	8: 94,679,368	Y96H	probably benign	Het
Polg2	A	G	11: 106,768,323	S455P	probably damaging	Het
Ppp1r9b	A	G	11: 94,992,211	T222A	probably benign	Het
Prkcd	G	A	14: 30,607,405	T26I	probably damaging	Het
Prkcq	A	G	2: 11,256,286	H383R	probably damaging	Het
Prune2	A	G	19: 17,124,948	I2490M	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Scn9a	G	A	2: 66,563,542	P229L	probably damaging	Het
Serpinb5	A	G	1: 106,876,123	T180A	probably damaging	Het
Slc5a2	G	C	7: 128,270,631	R412P	probably damaging	Het
Sphk2	A	G	7: 45,712,291	I82T	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Treml1	T	G	17: 48,360,198	V37G	probably damaging	Het
Trim33	A	G	3: 103,310,950	K272E	possibly damaging	Het
Trpv6	T	C	6: 41,621,129	D748G	probably benign	Het
Ubr4	A	G	4: 139,402,612	H681R	probably benign	Het
Uhrf1bp1l	A	G	10: 89,790,641	N399S	possibly damaging	Het
Vmn2r82	A	T	10: 79,396,491	R775*	probably null	Het
Zfand4	G	A	6: 116,273,638	G10R	probably damaging	Het
Zfp119a	T	A	17: 55,865,826	H339L	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het

Other mutations in Xpo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Xpo1	APN	11	23285094	missense	probably damaging	1.00
IGL01464:Xpo1	APN	11	23267703	missense	probably damaging	0.97
IGL01561:Xpo1	APN	11	23282706	missense	possibly damaging	0.76
IGL01630:Xpo1	APN	11	23285846	missense	probably benign	0.00
IGL01700:Xpo1	APN	11	23276422	splice site	probably benign
IGL02000:Xpo1	APN	11	23296003	missense	probably damaging	1.00
IGL02299:Xpo1	APN	11	23293915	splice site	probably benign
IGL02313:Xpo1	APN	11	23277065	missense	probably damaging	1.00
IGL02828:Xpo1	APN	11	23282593	missense	probably damaging	0.97
IGL03210:Xpo1	APN	11	23278834	missense	probably benign	0.01
IGL03329:Xpo1	APN	11	23284306	missense	probably benign
PIT1430001:Xpo1	UTSW	11	23276437	missense	possibly damaging	0.66
R0507:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R0594:Xpo1	UTSW	11	23280402	missense	probably damaging	1.00
R0706:Xpo1	UTSW	11	23280441	missense	probably benign	0.09
R0742:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R1478:Xpo1	UTSW	11	23291623	missense	probably damaging	0.99
R1483:Xpo1	UTSW	11	23284863	missense	probably benign	0.04
R1694:Xpo1	UTSW	11	23281399	missense	probably benign	0.12
R1775:Xpo1	UTSW	11	23271193	missense	probably benign
R1827:Xpo1	UTSW	11	23285155	missense	probably benign	0.00
R2262:Xpo1	UTSW	11	23284634	splice site	probably null
R2263:Xpo1	UTSW	11	23284634	splice site	probably null
R4510:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4511:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4840:Xpo1	UTSW	11	23278183	missense	probably damaging	1.00
R4901:Xpo1	UTSW	11	23281327	missense	possibly damaging	0.62
R5176:Xpo1	UTSW	11	23295977	missense	probably damaging	0.99
R5508:Xpo1	UTSW	11	23294645	missense	probably benign
R5927:Xpo1	UTSW	11	23268653	unclassified	probably benign
R5927:Xpo1	UTSW	11	23268656	unclassified	probably benign
R6110:Xpo1	UTSW	11	23287434	missense	probably damaging	0.99
R6421:Xpo1	UTSW	11	23291490	missense	possibly damaging	0.60
R6591:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6691:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6698:Xpo1	UTSW	11	23294040	missense	probably benign	0.01
R6958:Xpo1	UTSW	11	23285855	missense	probably benign
R7407:Xpo1	UTSW	11	23285823	missense	probably damaging	1.00
R7482:Xpo1	UTSW	11	23282544	missense	probably benign	0.00
R7624:Xpo1	UTSW	11	23282584	missense	probably damaging	0.99
R8335:Xpo1	UTSW	11	23280603	splice site	probably null
R8823:Xpo1	UTSW	11	23267752	missense	probably benign
R9128:Xpo1	UTSW	11	23285058	missense	probably damaging	1.00
R9232:Xpo1	UTSW	11	23282646	missense	probably benign
R9277:Xpo1	UTSW	11	23291550	missense	probably benign	0.17
Z1176:Xpo1	UTSW	11	23296080	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTAGCTGAGCAGCTTGGATGTAGA -3'
(R):5'- ACTGTCTCAAAAGGAACCAGACTAGCAT -3'

Sequencing Primer
(F):5'- tgcttgtttgtttgctttttttttg -3'
(R):5'- ACCAGACTAGCATATTCCTAATTTCC -3'

Posted On

2014-03-17