Incidental Mutation 'R1385:Xpo1'
ID 163225
Institutional Source Beutler Lab
Gene Symbol Xpo1
Ensembl Gene ENSMUSG00000020290
Gene Name exportin 1
Synonyms Crm1
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1385 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23256041-23298249 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23261863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 8 (L8S)
Ref Sequence ENSEMBL: ENSMUSP00000123634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551] [ENSMUST00000136235]
AlphaFold Q6P5F9
Predicted Effect probably benign
Transcript: ENSMUST00000020538
AA Change: L8S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: L8S

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102869
AA Change: L8S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: L8S

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 7.4e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102870
AA Change: L8S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: L8S

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109551
AA Change: L8S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: L8S

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136235
AA Change: L8S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123634
Gene: ENSMUSG00000020290
AA Change: L8S

DomainStartEndE-ValueType
PDB:4BSN|A 1 59 4e-35 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149371
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Xpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Xpo1 APN 11 23285094 missense probably damaging 1.00
IGL01464:Xpo1 APN 11 23267703 missense probably damaging 0.97
IGL01561:Xpo1 APN 11 23282706 missense possibly damaging 0.76
IGL01630:Xpo1 APN 11 23285846 missense probably benign 0.00
IGL01700:Xpo1 APN 11 23276422 splice site probably benign
IGL02000:Xpo1 APN 11 23296003 missense probably damaging 1.00
IGL02299:Xpo1 APN 11 23293915 splice site probably benign
IGL02313:Xpo1 APN 11 23277065 missense probably damaging 1.00
IGL02828:Xpo1 APN 11 23282593 missense probably damaging 0.97
IGL03210:Xpo1 APN 11 23278834 missense probably benign 0.01
IGL03329:Xpo1 APN 11 23284306 missense probably benign
PIT1430001:Xpo1 UTSW 11 23276437 missense possibly damaging 0.66
R0507:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R0594:Xpo1 UTSW 11 23280402 missense probably damaging 1.00
R0706:Xpo1 UTSW 11 23280441 missense probably benign 0.09
R0742:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R1478:Xpo1 UTSW 11 23291623 missense probably damaging 0.99
R1483:Xpo1 UTSW 11 23284863 missense probably benign 0.04
R1694:Xpo1 UTSW 11 23281399 missense probably benign 0.12
R1775:Xpo1 UTSW 11 23271193 missense probably benign
R1827:Xpo1 UTSW 11 23285155 missense probably benign 0.00
R2262:Xpo1 UTSW 11 23284634 splice site probably null
R2263:Xpo1 UTSW 11 23284634 splice site probably null
R4510:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4511:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4840:Xpo1 UTSW 11 23278183 missense probably damaging 1.00
R4901:Xpo1 UTSW 11 23281327 missense possibly damaging 0.62
R5176:Xpo1 UTSW 11 23295977 missense probably damaging 0.99
R5508:Xpo1 UTSW 11 23294645 missense probably benign
R5927:Xpo1 UTSW 11 23268653 unclassified probably benign
R5927:Xpo1 UTSW 11 23268656 unclassified probably benign
R6110:Xpo1 UTSW 11 23287434 missense probably damaging 0.99
R6421:Xpo1 UTSW 11 23291490 missense possibly damaging 0.60
R6591:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6691:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6698:Xpo1 UTSW 11 23294040 missense probably benign 0.01
R6958:Xpo1 UTSW 11 23285855 missense probably benign
R7407:Xpo1 UTSW 11 23285823 missense probably damaging 1.00
R7482:Xpo1 UTSW 11 23282544 missense probably benign 0.00
R7624:Xpo1 UTSW 11 23282584 missense probably damaging 0.99
R8335:Xpo1 UTSW 11 23280603 splice site probably null
R8823:Xpo1 UTSW 11 23267752 missense probably benign
R9128:Xpo1 UTSW 11 23285058 missense probably damaging 1.00
R9232:Xpo1 UTSW 11 23282646 missense probably benign
R9277:Xpo1 UTSW 11 23291550 missense probably benign 0.17
Z1176:Xpo1 UTSW 11 23296080 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAGCTGAGCAGCTTGGATGTAGA -3'
(R):5'- ACTGTCTCAAAAGGAACCAGACTAGCAT -3'

Sequencing Primer
(F):5'- tgcttgtttgtttgctttttttttg -3'
(R):5'- ACCAGACTAGCATATTCCTAATTTCC -3'
Posted On 2014-03-17