Incidental Mutation 'R1385:Arf3'
ID163237
Institutional Source Beutler Lab
Gene Symbol Arf3
Ensembl Gene ENSMUSG00000051853
Gene NameADP-ribosylation factor 3
Synonyms
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1385 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98736634-98763214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98742613 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 43 (V43A)
Ref Sequence ENSEMBL: ENSMUSP00000114739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053183] [ENSMUST00000156572]
Predicted Effect probably damaging
Transcript: ENSMUST00000053183
AA Change: V43A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050689
Gene: ENSMUSG00000051853
AA Change: V43A

DomainStartEndE-ValueType
ARF 1 181 2.95e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129354
Predicted Effect probably damaging
Transcript: ENSMUST00000156572
AA Change: V43A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factor 3 (ARF3) is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 6 ARF proteins and 11 ARF-like proteins and constitute 1 family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2,and ARF3), class II (ARF4 and ARF5) and class III (ARF6) and members of each class share a common gene organization. The ARF3 gene contains five exons and four introns. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Arf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0941:Arf3 UTSW 15 98741103 missense probably benign 0.19
R1591:Arf3 UTSW 15 98742788 start gained probably benign
R1808:Arf3 UTSW 15 98741073 missense probably benign
R2197:Arf3 UTSW 15 98741404 missense probably benign 0.02
R7316:Arf3 UTSW 15 98740993 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCAGGAACATCAAAGCCCTTC -3'
(R):5'- GGCCCTATTGACTTAAAGCAGCCAC -3'

Sequencing Primer
(F):5'- CAAGCCTAATGCCTGAGGG -3'
(R):5'- GCCACTGTAATCATGGGCAATATC -3'
Posted On2014-03-17