Incidental Mutation 'R1385:Zfp119a'
ID163243
Institutional Source Beutler Lab
Gene Symbol Zfp119a
Ensembl Gene ENSMUSG00000057835
Gene Namezinc finger protein 119a
SynonymsMzf13, Zfp119
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1385 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location55864892-55878930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55865826 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 339 (H339L)
Ref Sequence ENSEMBL: ENSMUSP00000078587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079642]
Predicted Effect probably damaging
Transcript: ENSMUST00000079642
AA Change: H339L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078587
Gene: ENSMUSG00000057835
AA Change: H339L

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
ZnF_C2H2 155 177 1.57e2 SMART
ZnF_C2H2 261 283 2.14e2 SMART
ZnF_C2H2 289 311 6.78e-3 SMART
ZnF_C2H2 317 339 1.98e-4 SMART
ZnF_C2H2 345 367 4.17e-3 SMART
ZnF_C2H2 373 395 3.39e-3 SMART
ZnF_C2H2 401 423 1.64e-1 SMART
ZnF_C2H2 429 451 5.5e-3 SMART
ZnF_C2H2 457 479 1.51e0 SMART
ZnF_C2H2 485 507 6.32e-3 SMART
ZnF_C2H2 513 535 1.69e-3 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Zfp119a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp119a APN 17 55865792 nonsense probably null
R0421:Zfp119a UTSW 17 55865248 nonsense probably null
R1600:Zfp119a UTSW 17 55868355 missense possibly damaging 0.93
R2310:Zfp119a UTSW 17 55865440 missense probably benign 0.00
R2924:Zfp119a UTSW 17 55868343 missense possibly damaging 0.96
R3910:Zfp119a UTSW 17 55866520 missense probably benign
R4594:Zfp119a UTSW 17 55866325 missense probably benign
R5217:Zfp119a UTSW 17 55865425 nonsense probably null
R5321:Zfp119a UTSW 17 55865595 missense probably damaging 1.00
R5392:Zfp119a UTSW 17 55866328 missense probably benign 0.03
R5678:Zfp119a UTSW 17 55868336 missense probably benign 0.03
R7033:Zfp119a UTSW 17 55866009 missense probably benign 0.04
R7355:Zfp119a UTSW 17 55866287 nonsense probably null
R7489:Zfp119a UTSW 17 55866158 missense probably damaging 1.00
R8130:Zfp119a UTSW 17 55865971 missense probably damaging 1.00
Z1176:Zfp119a UTSW 17 55866011 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGGGAAATGAGTGTGTTACCCAAGACTA -3'
(R):5'- tcctCTTTACAGCTACACCGAAGAACT -3'

Sequencing Primer
(F):5'- tttttctccagtatgacacctttc -3'
(R):5'- gctttttcgtatcccagttatcttc -3'
Posted On2014-03-17