Incidental Mutation 'R0084:Tirap'
ID163257
Institutional Source Beutler Lab
Gene Symbol Tirap
Ensembl Gene ENSMUSG00000032041
Gene Nametoll-interleukin 1 receptor (TIR) domain-containing adaptor protein
SynonymsMal, Mal, wyatt, MyD88-adapter-like, C130027E04Rik
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35184551-35200291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35189162 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 75 (H75Q)
Ref Sequence ENSEMBL: ENSMUSP00000135462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175765] [ENSMUST00000176021] [ENSMUST00000176531] [ENSMUST00000176611] [ENSMUST00000176685] [ENSMUST00000177052] [ENSMUST00000177129]
Predicted Effect probably benign
Transcript: ENSMUST00000175765
AA Change: H75Q

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135435
Gene: ENSMUSG00000032041
AA Change: H75Q

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 113 206 2.4e-8 PFAM
Pfam:TIR_2 116 226 1.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176021
AA Change: H75Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135738
Gene: ENSMUSG00000032041
AA Change: H75Q

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 116 215 3.1e-10 PFAM
Pfam:TIR_2 116 219 6.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176531
AA Change: H75Q

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135224
Gene: ENSMUSG00000032041
AA Change: H75Q

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 116 225 2.6e-10 PFAM
Pfam:TIR_2 116 226 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176611
AA Change: H75Q

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000134984
Gene: ENSMUSG00000032041
AA Change: H75Q

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176685
AA Change: H75Q

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135876
Gene: ENSMUSG00000032041
AA Change: H75Q

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 116 225 2.6e-10 PFAM
Pfam:TIR_2 116 226 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177052
Predicted Effect probably benign
Transcript: ENSMUST00000177129
AA Change: H75Q

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135462
Gene: ENSMUSG00000032041
AA Change: H75Q

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 116 225 2.6e-10 PFAM
Pfam:TIR_2 116 226 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214606
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The innate immune system recognizes microbial pathogens through Toll-like receptors (TLRs), which identify pathogen-associated molecular patterns. Different TLRs recognize different pathogen-associated molecular patterns and all TLRs have a Toll-interleukin 1 receptor (TIR) domain, which is responsible for signal transduction. The protein encoded by this gene is a TIR adaptor protein involved in the TLR4 signaling pathway of the immune system. It activates NF-kappa-B, MAPK1, MAPK3 and JNK, which then results in cytokine secretion and the inflammatory response. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene lead to impaired cytokine secretion in response to TLR2 and TLR4 ligands. Homozygous null mice may also show low serum IgG3 levels, a reduced response to attenuated yellow fever vaccine, high susceptibility to bacterial infection, and altered response to myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Tirap
AlleleSourceChrCoordTypePredicted EffectPPH Score
torpid UTSW 9 35198707 intron probably benign
R0184:Tirap UTSW 9 35189194 missense probably benign 0.09
R0594:Tirap UTSW 9 35188761 missense probably damaging 1.00
R1490:Tirap UTSW 9 35189066 small deletion probably benign
R1833:Tirap UTSW 9 35188703 missense probably benign 0.19
R1993:Tirap UTSW 9 35191016 critical splice donor site probably null
R5703:Tirap UTSW 9 35188758 missense probably damaging 1.00
R5875:Tirap UTSW 9 35189169 missense probably damaging 0.96
R7257:Tirap UTSW 9 35189034 missense probably damaging 1.00
R7283:Tirap UTSW 9 35188929 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTACGACTCAGTGCCTGGCATAG -3'
(R):5'- TCACAAGTCTCAGCCCAGTGTTTC -3'

Sequencing Primer
(F):5'- TGGCATAGCTCCGAAACAATG -3'
(R):5'- AGTGTTTCTCCCCTGTAGACTG -3'
Posted On2014-03-19