Incidental Mutation 'R0084:Map4k3'
ID163262
Institutional Source Beutler Lab
Gene Symbol Map4k3
Ensembl Gene ENSMUSG00000024242
Gene Namemitogen-activated protein kinase kinase kinase kinase 3
Synonyms
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0084 (G1)
Quality Score206
Status Validated
Chromosome17
Chromosomal Location80580512-80728093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80655914 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 85 (K85E)
Ref Sequence ENSEMBL: ENSMUSP00000025089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025089] [ENSMUST00000112389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025089
AA Change: K85E

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025089
Gene: ENSMUSG00000024242
AA Change: K85E

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 874 2e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112389
AA Change: K85E

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108008
Gene: ENSMUSG00000024242
AA Change: K85E

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 876 1.39e-114 SMART
Meta Mutation Damage Score 0.5046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Map4k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Map4k3 APN 17 80636718 critical splice donor site probably null
IGL01329:Map4k3 APN 17 80644184 missense probably benign
IGL01626:Map4k3 APN 17 80605809 missense probably damaging 0.97
IGL01896:Map4k3 APN 17 80613931 missense probably benign 0.13
IGL02021:Map4k3 APN 17 80609826 missense probably damaging 1.00
IGL02585:Map4k3 APN 17 80653919 splice site probably benign
IGL03101:Map4k3 APN 17 80655855 critical splice donor site probably null
IGL03231:Map4k3 APN 17 80597675 missense probably damaging 1.00
IGL03267:Map4k3 APN 17 80664028 missense probably damaging 1.00
maple_forest UTSW 17 80603998 missense probably benign 0.38
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0612:Map4k3 UTSW 17 80602193 missense probably damaging 1.00
R0842:Map4k3 UTSW 17 80605983 missense probably benign 0.35
R2009:Map4k3 UTSW 17 80664088 splice site probably benign
R2224:Map4k3 UTSW 17 80630454 missense probably benign 0.00
R3851:Map4k3 UTSW 17 80644323 splice site probably benign
R4049:Map4k3 UTSW 17 80605965 missense probably benign 0.10
R4151:Map4k3 UTSW 17 80644534 missense probably damaging 1.00
R4345:Map4k3 UTSW 17 80597551 critical splice donor site probably null
R4405:Map4k3 UTSW 17 80615015 critical splice donor site probably null
R4450:Map4k3 UTSW 17 80603982 critical splice donor site probably null
R4970:Map4k3 UTSW 17 80653903 missense probably benign 0.00
R5230:Map4k3 UTSW 17 80615170 missense probably benign 0.00
R5459:Map4k3 UTSW 17 80609787 missense probably damaging 1.00
R5568:Map4k3 UTSW 17 80663998 missense possibly damaging 0.96
R5635:Map4k3 UTSW 17 80613495 missense possibly damaging 0.94
R5827:Map4k3 UTSW 17 80593283 critical splice donor site probably null
R5927:Map4k3 UTSW 17 80613919 missense probably benign 0.06
R5951:Map4k3 UTSW 17 80603998 missense probably benign 0.38
R5964:Map4k3 UTSW 17 80644762 missense probably damaging 1.00
R6849:Map4k3 UTSW 17 80630413 critical splice donor site probably null
R6985:Map4k3 UTSW 17 80636732 missense probably damaging 1.00
R7040:Map4k3 UTSW 17 80680915 missense probably damaging 0.98
R7233:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7511:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7672:Map4k3 UTSW 17 80615071 missense possibly damaging 0.58
R7680:Map4k3 UTSW 17 80581876 missense probably benign 0.02
R7804:Map4k3 UTSW 17 80615070 missense probably damaging 0.98
X0023:Map4k3 UTSW 17 80593091 missense probably benign
Z1176:Map4k3 UTSW 17 80618337
Predicted Primers PCR Primer
(F):5'- GACCAGTCTCTGGATGCACAGAAC -3'
(R):5'- CCATCTTGGGCTGTGAGTGAGAAATAC -3'

Sequencing Primer
(F):5'- TCTCTGGATGCACAGAACTACAC -3'
(R):5'- tggcacaccttttaatctcaac -3'
Posted On2014-03-19