Incidental Mutation 'R1484:Nbeal1'
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission 039537-MU
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60200939 bp
Amino Acid Change Phenylalanine to Leucine at position 155 (F155L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834]
Predicted Effect probably damaging
Transcript: ENSMUST00000035569
AA Change: F155L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049393
Gene: ENSMUSG00000073664
AA Change: F155L

low complexity region 522 541 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
Pfam:DUF4704 851 1130 3.4e-39 PFAM
low complexity region 1383 1401 N/A INTRINSIC
Pfam:DUF4800 1575 1828 6.3e-126 PFAM
coiled coil region 1859 1882 N/A INTRINSIC
Pfam:PH_BEACH 1889 1975 2e-24 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160834
AA Change: F155L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: F155L

low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Ano5 T A 7: 51,566,320 D348E probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
C2cd3 C T 7: 100,440,190 R1638W probably damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Esrra T C 19: 6,912,829 Y209C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nfya A T 17: 48,393,542 probably benign Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Pigo G C 4: 43,024,779 P107A probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema3a T G 5: 13,473,440 N125K probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Unc13d C A 11: 116,073,875 R255L possibly damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wdr63 T C 3: 146,097,241 D65G probably benign Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
Committee UTSW 1 60292903 missense probably damaging 1.00
Disgrace UTSW 1 60281310 nonsense probably null
Dravrah UTSW 1 60284092 missense probably damaging 1.00
Harvard UTSW 1 60235563 unclassified probably null
Lampoon UTSW 1 60261586 critical splice donor site probably null
lawyer UTSW 1 60310224 nonsense probably null
magistrate UTSW 1 60194597 critical splice donor site probably null
National UTSW 1 60222263 missense possibly damaging 0.95
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
stiggs UTSW 1 60237151 missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 unclassified probably null
R4798:Nbeal1 UTSW 1 60222193 unclassified probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60310224 nonsense probably null
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60217196 missense probably benign 0.39
R7380:Nbeal1 UTSW 1 60244810 missense probably damaging 1.00
R7414:Nbeal1 UTSW 1 60194597 critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60261584 missense probably benign
R7507:Nbeal1 UTSW 1 60235467 missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60277227 missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60244824 missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60257450 missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60319341 missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60291889 missense probably damaging 1.00
R7829:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7891:Nbeal1 UTSW 1 60260432 missense probably benign
R7902:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R7974:Nbeal1 UTSW 1 60260432 missense probably benign
R7985:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60260272 nonsense probably null
R8053:Nbeal1 UTSW 1 60279795 missense probably damaging 0.98
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gttttcctgtctccattttcatttc -3'
Posted On2014-03-28