Incidental Mutation 'R1484:Wdr63'
Institutional Source Beutler Lab
Gene Symbol Wdr63
Ensembl Gene ENSMUSG00000043020
Gene NameWD repeat domain 63
MMRRC Submission 039537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosomal Location146040526-146108130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146097241 bp
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000124475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160285]
Predicted Effect probably benign
Transcript: ENSMUST00000160285
AA Change: D65G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124475
Gene: ENSMUSG00000043020
AA Change: D65G

low complexity region 3 22 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
Blast:WD40 321 367 6e-19 BLAST
low complexity region 375 383 N/A INTRINSIC
WD40 390 429 6.34e-2 SMART
WD40 470 527 1.15e-4 SMART
low complexity region 536 553 N/A INTRINSIC
WD40 693 732 1.07e1 SMART
WD40 737 776 1.1e2 SMART
coiled coil region 867 902 N/A INTRINSIC
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Ano5 T A 7: 51,566,320 D348E probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
C2cd3 C T 7: 100,440,190 R1638W probably damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Esrra T C 19: 6,912,829 Y209C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nbeal1 T C 1: 60,200,939 F155L probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nfya A T 17: 48,393,542 probably benign Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Pigo G C 4: 43,024,779 P107A probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema3a T G 5: 13,473,440 N125K probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Unc13d C A 11: 116,073,875 R255L possibly damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in Wdr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wdr63 APN 3 146083004 missense probably benign
IGL00565:Wdr63 APN 3 146044919 splice site probably benign
IGL01339:Wdr63 APN 3 146042836 missense probably benign 0.14
IGL01952:Wdr63 APN 3 146097163 missense probably damaging 0.96
IGL02663:Wdr63 APN 3 146054557 missense possibly damaging 0.53
IGL02710:Wdr63 APN 3 146048148 missense possibly damaging 0.96
P0041:Wdr63 UTSW 3 146081242 missense possibly damaging 0.96
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0498:Wdr63 UTSW 3 146081364 missense possibly damaging 0.54
R0589:Wdr63 UTSW 3 146062331 missense probably benign 0.01
R1537:Wdr63 UTSW 3 146042749 missense probably damaging 0.98
R1611:Wdr63 UTSW 3 146095358 missense probably damaging 1.00
R1743:Wdr63 UTSW 3 146097262 missense possibly damaging 0.81
R1861:Wdr63 UTSW 3 146083046 missense probably damaging 1.00
R1991:Wdr63 UTSW 3 146063480 missense possibly damaging 0.82
R2185:Wdr63 UTSW 3 146066864 missense possibly damaging 0.76
R4299:Wdr63 UTSW 3 146068806 missense probably damaging 1.00
R4620:Wdr63 UTSW 3 146042809 missense probably damaging 1.00
R4649:Wdr63 UTSW 3 146048167 missense probably damaging 1.00
R4914:Wdr63 UTSW 3 146066827 missense probably damaging 0.98
R4948:Wdr63 UTSW 3 146083065 nonsense probably null
R5578:Wdr63 UTSW 3 146097228 nonsense probably null
R6130:Wdr63 UTSW 3 146042804 missense probably benign 0.25
R6162:Wdr63 UTSW 3 146044862 missense probably damaging 1.00
R6291:Wdr63 UTSW 3 146066893 missense probably benign 0.00
R6390:Wdr63 UTSW 3 146095388 missense probably damaging 1.00
R6560:Wdr63 UTSW 3 146095406 missense possibly damaging 0.79
R6893:Wdr63 UTSW 3 146080429 missense probably damaging 1.00
R7090:Wdr63 UTSW 3 146040827 missense possibly damaging 0.80
R7102:Wdr63 UTSW 3 146055704 missense possibly damaging 0.49
R7111:Wdr63 UTSW 3 146097273 missense probably damaging 0.99
R7260:Wdr63 UTSW 3 146046540 missense probably benign 0.01
R7288:Wdr63 UTSW 3 146081252 missense probably damaging 0.97
R7411:Wdr63 UTSW 3 146097145 missense probably damaging 0.98
R7417:Wdr63 UTSW 3 146093080 splice site probably null
R7466:Wdr63 UTSW 3 146055618 missense probably benign 0.01
R7860:Wdr63 UTSW 3 146066920 missense probably damaging 0.99
R7943:Wdr63 UTSW 3 146066920 missense probably damaging 0.99
R8013:Wdr63 UTSW 3 146081285 missense probably damaging 1.00
R8059:Wdr63 UTSW 3 146046673 missense possibly damaging 0.75
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcctcagacttgtgatttttcc -3'
Posted On2014-03-28