Incidental Mutation 'R1484:Sema3a'
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
SynonymsSemad, semaphorin III, SemD, sema III, collapsin-1
MMRRC Submission 039537-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosomal Location13125414-13602565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13473440 bp
Amino Acid Change Asparagine to Lysine at position 125 (N125K)
Ref Sequence ENSEMBL: ENSMUSP00000128153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000137798]
Predicted Effect probably damaging
Transcript: ENSMUST00000030714
AA Change: N125K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883
AA Change: N125K

Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095012
AA Change: N125K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883
AA Change: N125K

Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137798
AA Change: N125K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883
AA Change: N125K

Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200073
Meta Mutation Damage Score 0.7216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Ano5 T A 7: 51,566,320 D348E probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
C2cd3 C T 7: 100,440,190 R1638W probably damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Esrra T C 19: 6,912,829 Y209C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nbeal1 T C 1: 60,200,939 F155L probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nfya A T 17: 48,393,542 probably benign Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Pigo G C 4: 43,024,779 P107A probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Unc13d C A 11: 116,073,875 R255L possibly damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wdr63 T C 3: 146,097,241 D65G probably benign Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13473466 missense probably damaging 1.00
IGL01783:Sema3a APN 5 13561800 missense probably damaging 1.00
IGL02423:Sema3a APN 5 13565809 missense probably damaging 1.00
IGL02728:Sema3a APN 5 13565914 missense probably damaging 1.00
IGL02739:Sema3a APN 5 13451161 missense probably damaging 1.00
IGL02987:Sema3a APN 5 13565896 missense probably damaging 1.00
IGL03106:Sema3a APN 5 13599488 missense probably damaging 1.00
R0055:Sema3a UTSW 5 13400037 missense possibly damaging 0.92
R0334:Sema3a UTSW 5 13557301 missense probably damaging 0.99
R0684:Sema3a UTSW 5 13556527 critical splice acceptor site probably null
R0750:Sema3a UTSW 5 13557125 critical splice donor site probably null
R1204:Sema3a UTSW 5 13523175 critical splice donor site probably benign
R1221:Sema3a UTSW 5 13516223 missense probably benign
R1663:Sema3a UTSW 5 13557125 critical splice donor site probably null
R2079:Sema3a UTSW 5 13451131 missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13473397 critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13570157 missense probably damaging 1.00
R4867:Sema3a UTSW 5 13451241 missense probably benign 0.05
R4904:Sema3a UTSW 5 13581098 missense probably damaging 1.00
R5107:Sema3a UTSW 5 13577604 nonsense probably null
R5327:Sema3a UTSW 5 13599389 missense probably benign 0.25
R5343:Sema3a UTSW 5 13473406 missense probably damaging 1.00
R5430:Sema3a UTSW 5 13565763 missense probably damaging 0.97
R5604:Sema3a UTSW 5 13473520 critical splice donor site probably null
R5774:Sema3a UTSW 5 13523164 missense probably damaging 1.00
R6057:Sema3a UTSW 5 13565865 missense probably damaging 1.00
R6110:Sema3a UTSW 5 13581001 missense probably damaging 1.00
R6132:Sema3a UTSW 5 13523175 critical splice donor site probably null
R6310:Sema3a UTSW 5 13557019 missense probably damaging 1.00
R6754:Sema3a UTSW 5 13599275 missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13597616 missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13455544 missense possibly damaging 0.88
R7411:Sema3a UTSW 5 13516263 nonsense probably null
R7501:Sema3a UTSW 5 13557041 missense probably damaging 1.00
R7514:Sema3a UTSW 5 13523126 missense probably benign 0.03
R7531:Sema3a UTSW 5 13565838 missense probably damaging 1.00
R7538:Sema3a UTSW 5 13561820 missense probably benign 0.42
X0064:Sema3a UTSW 5 13581098 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggacccttccctatcaatcac -3'
Posted On2014-03-28