Incidental Mutation 'R1484:Ano5'
ID163313
Institutional Source Beutler Lab
Gene Symbol Ano5
Ensembl Gene ENSMUSG00000055489
Gene Nameanoctamin 5
SynonymsGdd1, Tmem16e
MMRRC Submission 039537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location51511029-51598709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51566320 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 348 (D348E)
Ref Sequence ENSEMBL: ENSMUSP00000046884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043944] [ENSMUST00000207044] [ENSMUST00000207717]
Predicted Effect probably damaging
Transcript: ENSMUST00000043944
AA Change: D348E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046884
Gene: ENSMUSG00000055489
AA Change: D348E

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:Anoct_dimer 64 280 7.7e-70 PFAM
Pfam:Anoctamin 283 860 6.5e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207044
AA Change: D315E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207717
AA Change: D334E

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.3013 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. Elevated levels of this protein were found in dystrophic mice. In humans, mutations of this gene are associated with with musculoskeletal disorders such as myopathies, muscular dystrophy and gnathodiaphyseal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: One type of homozygous KO causes abnormalities in skeletal muscle mitochondria and impairs muscle regeneration and repair, leading to exercise intolerance. Another type of homozygous KO impairs sperm motility, leading to male subfertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
C2cd3 C T 7: 100,440,190 R1638W probably damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Esrra T C 19: 6,912,829 Y209C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nbeal1 T C 1: 60,200,939 F155L probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nfya A T 17: 48,393,542 probably benign Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Pigo G C 4: 43,024,779 P107A probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema3a T G 5: 13,473,440 N125K probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Unc13d C A 11: 116,073,875 R255L possibly damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wdr63 T C 3: 146,097,241 D65G probably benign Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in Ano5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Ano5 APN 7 51566513 missense probably damaging 0.96
IGL01328:Ano5 APN 7 51556271 critical splice donor site probably null
IGL01800:Ano5 APN 7 51573075 critical splice donor site probably null
IGL01888:Ano5 APN 7 51566300 missense probably benign 0.06
IGL02221:Ano5 APN 7 51570323 missense probably damaging 1.00
IGL02538:Ano5 APN 7 51583775 missense probably damaging 1.00
IGL03027:Ano5 APN 7 51566277 missense probably damaging 0.99
IGL03133:Ano5 APN 7 51576512 nonsense probably null
IGL03167:Ano5 APN 7 51585511 missense probably damaging 0.98
IGL03233:Ano5 APN 7 51570368 missense probably damaging 1.00
PIT4466001:Ano5 UTSW 7 51544851 missense probably damaging 1.00
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0675:Ano5 UTSW 7 51574810 missense probably damaging 1.00
R0723:Ano5 UTSW 7 51587758 missense probably benign 0.20
R0764:Ano5 UTSW 7 51537842 splice site probably benign
R1159:Ano5 UTSW 7 51579474 splice site probably benign
R1218:Ano5 UTSW 7 51570421 splice site probably null
R1288:Ano5 UTSW 7 51546872 missense probably damaging 1.00
R1329:Ano5 UTSW 7 51546785 missense probably benign
R1496:Ano5 UTSW 7 51583775 missense probably damaging 1.00
R1512:Ano5 UTSW 7 51579568 missense probably benign 0.00
R1691:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R1859:Ano5 UTSW 7 51546833 missense probably damaging 1.00
R1991:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2066:Ano5 UTSW 7 51585386 missense probably damaging 1.00
R2088:Ano5 UTSW 7 51587706 missense possibly damaging 0.50
R2103:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2248:Ano5 UTSW 7 51593789 missense probably benign 0.00
R3692:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R3723:Ano5 UTSW 7 51576528 missense probably damaging 1.00
R3805:Ano5 UTSW 7 51576650 missense probably benign 0.22
R3883:Ano5 UTSW 7 51566304 missense probably damaging 1.00
R3978:Ano5 UTSW 7 51587806 missense probably benign
R4035:Ano5 UTSW 7 51566485 splice site probably benign
R4239:Ano5 UTSW 7 51587666 missense probably damaging 0.99
R4466:Ano5 UTSW 7 51570275 missense probably damaging 1.00
R4644:Ano5 UTSW 7 51587685 nonsense probably null
R5021:Ano5 UTSW 7 51556185 missense probably benign
R5028:Ano5 UTSW 7 51537710 splice site probably null
R5609:Ano5 UTSW 7 51593637 missense probably damaging 1.00
R5659:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5660:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5680:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5786:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5787:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5788:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5856:Ano5 UTSW 7 51585326 missense probably benign 0.01
R5930:Ano5 UTSW 7 51585331 missense probably damaging 0.99
R5984:Ano5 UTSW 7 51593664 missense probably damaging 1.00
R6015:Ano5 UTSW 7 51574777 missense probably benign 0.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R6247:Ano5 UTSW 7 51566131 intron probably null
R7552:Ano5 UTSW 7 51546780 missense probably benign 0.31
R7559:Ano5 UTSW 7 51574888 missense probably damaging 1.00
R7712:Ano5 UTSW 7 51573057 missense probably benign 0.00
R7712:Ano5 UTSW 7 51590655 missense probably damaging 1.00
R7805:Ano5 UTSW 7 51537800 missense probably damaging 0.97
R7808:Ano5 UTSW 7 51587795 missense possibly damaging 0.53
R7840:Ano5 UTSW 7 51587732 missense possibly damaging 0.88
R7886:Ano5 UTSW 7 51570393 missense probably benign 0.12
R7923:Ano5 UTSW 7 51587732 missense possibly damaging 0.88
R7969:Ano5 UTSW 7 51570393 missense probably benign 0.12
R8006:Ano5 UTSW 7 51593770 missense probably benign 0.05
R8060:Ano5 UTSW 7 51587783 missense probably benign 0.01
X0062:Ano5 UTSW 7 51593651 nonsense probably null
X0065:Ano5 UTSW 7 51576628 nonsense probably null
Z1176:Ano5 UTSW 7 51574703 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGGGCTGTTTCAGAAAGTGTAGTTTAC -3'
(R):5'- AAGGAGACCTTGTACTCACCCCAG -3'

Sequencing Primer
(F):5'- CAGAAAGTGTAGTTTACAGACTCC -3'
(R):5'- CTCGTTATCAAACAGATGGGAGAAC -3'
Posted On2014-03-28