Mutagenetix > Incidental Mutations

Incidental Mutation 'R1484:Muc5ac'

163318

Institutional Source

Beutler Lab

Gene Symbol

Muc5ac

Ensembl Gene

ENSMUSG00000037974

Gene Name

mucin 5, subtypes A and C, tracheobronchial/gastric

Synonyms

MGM, 2210005L13Rik

MMRRC Submission

039537-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1484 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141788972-141819231 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 141813892 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]

Predicted Effect

probably null
Transcript: ENSMUST00000041924

SMART Domains

Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	1.6e-14	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	6.1e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1482	2.3e-25	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1692	2.2e-27	PFAM
Pfam:Mucin2_WxxW	1765	1857	8.6e-27	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000155534

SMART Domains

Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	9.6e-15	PFAM
VWC	395	437	3.54e-1	SMART
VWD	422	586	2.35e-33	SMART
C8	623	697	8.42e-36	SMART
Pfam:TIL	703	760	3.6e-9	PFAM
VWC	762	826	6.75e-1	SMART
VWC	864	906	4.06e-1	SMART
VWD	891	1051	1.51e-45	SMART
C8	1087	1161	2.78e-36	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1334	1367	N/A	INTRINSIC
low complexity region	1372	1388	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1395	1483	1.3e-25	PFAM
low complexity region	1522	1533	N/A	INTRINSIC
low complexity region	1537	1564	N/A	INTRINSIC
low complexity region	1579	1596	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1605	1693	1.3e-27	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000163321

SMART Domains

Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	7.9e-15	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	1.9e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1481	1.1e-23	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1691	1.1e-25	PFAM
Pfam:Mucin2_WxxW	1765	1856	6.3e-24	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

97% (85/88)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	T	5: 26,479,778		noncoding transcript	Het
Acvr1	A	T	2: 58,479,889	V36E	probably damaging	Het
Aldh4a1	A	G	4: 139,643,447	I414V	probably benign	Het
Alox5	C	T	6: 116,454,167	C100Y	probably damaging	Het
Ano5	T	A	7: 51,566,320	D348E	probably damaging	Het
Arhgap30	G	A	1: 171,403,271	V199M	probably damaging	Het
Arl13b	T	A	16: 62,806,636	Q234L	probably benign	Het
Atxn1	C	A	13: 45,557,576	E627*	probably null	Het
Bend3	T	C	10: 43,510,201	F197L	probably benign	Het
Brca1	A	T	11: 101,529,812	V190E	possibly damaging	Het
Brpf1	T	C	6: 113,315,135	W381R	probably damaging	Het
Brwd1	A	C	16: 96,028,291		probably null	Het
C1s2	T	C	6: 124,625,645	I530V	possibly damaging	Het
C2cd3	C	T	7: 100,440,190	R1638W	probably damaging	Het
Capns1	T	A	7: 30,194,086		probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cep126	G	A	9: 8,100,553	T660I	possibly damaging	Het
Cep295	A	C	9: 15,334,784	I744R	probably damaging	Het
Chd3	T	C	11: 69,359,899	E668G	probably benign	Het
Chek2	A	G	5: 110,848,687	T172A	probably damaging	Het
Col6a4	A	G	9: 106,013,302		probably null	Het
Coq3	G	A	4: 21,900,291	V173I	probably benign	Het
Cyp4x1	A	T	4: 115,112,901	I343N	probably damaging	Het
D430042O09Rik	C	A	7: 125,816,571		probably benign	Het
Dnah7b	T	A	1: 46,137,543	D774E	probably benign	Het
Ecm1	G	A	3: 95,735,963	R342C	probably damaging	Het
Esrra	T	C	19: 6,912,829	Y209C	probably damaging	Het
Gpr149	A	T	3: 62,595,171	D421E	probably benign	Het
Gpr15	T	C	16: 58,718,574	N51D	probably damaging	Het
Gpr156	T	C	16: 37,992,196	V298A	probably damaging	Het
Hmcn2	G	A	2: 31,346,495	G350D	probably damaging	Het
Ifih1	A	T	2: 62,610,558	N421K	probably benign	Het
Ilvbl	C	A	10: 78,576,730	T95K	probably damaging	Het
Itgb4	T	A	11: 115,999,799	D1104E	probably benign	Het
Lipf	A	T	19: 33,964,780	M37L	probably benign	Het
Lyst	T	A	13: 13,678,190	N2258K	probably benign	Het
Moxd1	A	G	10: 24,223,860	Y86C	probably damaging	Het
Myo16	G	A	8: 10,560,145	R1162H	probably damaging	Het
Myo5c	A	T	9: 75,300,810	N1609Y	probably damaging	Het
Nbeal1	T	C	1: 60,200,939	F155L	probably damaging	Het
Nek4	A	T	14: 30,982,333	M602L	possibly damaging	Het
Nek9	A	G	12: 85,301,848	S971P	probably damaging	Het
Nfya	A	T	17: 48,393,542		probably benign	Het
Nrxn3	A	T	12: 89,254,777	N442I	probably damaging	Het
Nupl2	A	C	5: 24,178,077	K200N	probably benign	Het
Olfr1216	G	A	2: 89,013,369	R232*	probably null	Het
Olfr385	T	A	11: 73,589,361	I126L	possibly damaging	Het
Olfr850	G	A	9: 19,478,127	T38I	probably damaging	Het
Pcdh15	T	A	10: 74,291,001	I304N	probably damaging	Het
Pigo	G	C	4: 43,024,779	P107A	probably damaging	Het
Plce1	C	T	19: 38,705,339	Q769*	probably null	Het
Plin2	C	T	4: 86,657,244	R356H	probably benign	Het
Ppp1r9a	G	T	6: 5,113,712	E739*	probably null	Het
Ppp3cc	G	T	14: 70,240,948	N268K	probably damaging	Het
Prkag3	T	A	1: 74,740,760	D472V	probably damaging	Het
Ptch2	A	T	4: 117,110,849	D846V	probably damaging	Het
Rhob	A	T	12: 8,499,388	M82K	probably damaging	Het
Rps6kc1	T	A	1: 190,799,475	R777W	possibly damaging	Het
Sap130	T	A	18: 31,711,327	V850E	probably damaging	Het
Sema3a	T	G	5: 13,473,440	N125K	probably damaging	Het
Sema5a	A	G	15: 32,460,285	D64G	probably damaging	Het
Sgo2b	T	A	8: 63,931,473	D163V	possibly damaging	Het
Slc15a1	A	T	14: 121,491,239	Y31*	probably null	Het
Smchd1	A	T	17: 71,378,257	M1392K	probably benign	Het
Sobp	T	A	10: 43,160,831	N37I	probably damaging	Het
Spock3	G	T	8: 63,220,705	C142F	probably damaging	Het
Stx6	A	C	1: 155,177,904	S86R	probably benign	Het
Sult2a4	C	A	7: 13,909,801	M280I	probably benign	Het
Synm	A	T	7: 67,736,332	D527E	probably damaging	Het
Tax1bp1	C	T	6: 52,733,320	R195W	probably damaging	Het
Themis2	A	T	4: 132,792,485	N76K	possibly damaging	Het
Tmem8b	A	G	4: 43,690,234	T890A	probably benign	Het
Traf7	T	A	17: 24,511,811	H366L	possibly damaging	Het
Trim30c	A	T	7: 104,383,252	V289D	probably benign	Het
Tsr1	T	A	11: 74,902,088	D407E	probably damaging	Het
Ubap2	G	T	4: 41,235,593	A33E	probably damaging	Het
Unc13d	C	A	11: 116,073,875	R255L	possibly damaging	Het
Ush2a	G	T	1: 188,810,337	G3367*	probably null	Het
Vmn1r229	T	C	17: 20,814,529	L12P	probably damaging	Het
Vmn2r27	C	A	6: 124,200,515	G510V	probably damaging	Het
Vps4b	T	C	1: 106,779,982	E257G	probably damaging	Het
Vps72	T	C	3: 95,119,151	S136P	probably damaging	Het
Wdr36	T	C	18: 32,843,885	I181T	possibly damaging	Het
Wdr63	T	C	3: 146,097,241	D65G	probably benign	Het
Wfikkn1	C	T	17: 25,877,791	A520T	probably benign	Het

Other mutations in Muc5ac

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Muc5ac	APN	7	141812703	missense	possibly damaging	0.93
IGL01064:Muc5ac	APN	7	141807473	missense	probably benign	0.12
IGL01155:Muc5ac	APN	7	141806943	splice site	probably benign
IGL01452:Muc5ac	APN	7	141817555	missense	probably benign	0.00
IGL01590:Muc5ac	APN	7	141798893	missense	probably benign	0.02
IGL02104:Muc5ac	APN	7	141811078	missense	probably damaging	0.98
IGL02152:Muc5ac	APN	7	141800177	missense	possibly damaging	0.86
IGL02153:Muc5ac	APN	7	141818800	nonsense	probably null
IGL02178:Muc5ac	APN	7	141805447	splice site	probably benign
IGL02403:Muc5ac	APN	7	141803450	missense	possibly damaging	0.71
IGL02576:Muc5ac	APN	7	141817044	missense	probably benign	0.01
IGL02665:Muc5ac	APN	7	141791086	missense	possibly damaging	0.71
IGL02704:Muc5ac	APN	7	141795263	missense	possibly damaging	0.71
IGL02808:Muc5ac	APN	7	141805775	missense	possibly damaging	0.72
IGL03283:Muc5ac	APN	7	141813781	missense	probably benign	0.34
IGL03384:Muc5ac	APN	7	141812403	missense	possibly damaging	0.71
IGL03046:Muc5ac	UTSW	7	141795213	missense	probably benign	0.27
PIT4515001:Muc5ac	UTSW	7	141807416	missense	probably damaging	0.99
R0092:Muc5ac	UTSW	7	141818630	missense	possibly damaging	0.72
R0145:Muc5ac	UTSW	7	141795275	missense	possibly damaging	0.71
R0147:Muc5ac	UTSW	7	141811039	missense	probably benign	0.08
R0363:Muc5ac	UTSW	7	141800960	missense	probably benign	0.01
R0384:Muc5ac	UTSW	7	141812251	missense	possibly damaging	0.71
R0440:Muc5ac	UTSW	7	141792034	nonsense	probably null
R0583:Muc5ac	UTSW	7	141807608	missense	probably damaging	0.99
R0616:Muc5ac	UTSW	7	141796244	missense	probably benign	0.02
R0682:Muc5ac	UTSW	7	141805669	missense	possibly damaging	0.53
R0685:Muc5ac	UTSW	7	141807709	missense	probably benign	0.03
R0883:Muc5ac	UTSW	7	141796265	missense	possibly damaging	0.71
R0924:Muc5ac	UTSW	7	141807515	missense	possibly damaging	0.68
R1300:Muc5ac	UTSW	7	141816929	missense	possibly damaging	0.73
R1315:Muc5ac	UTSW	7	141807323	missense	probably damaging	0.99
R1354:Muc5ac	UTSW	7	141807377	missense	probably damaging	0.99
R1599:Muc5ac	UTSW	7	141798903	missense	possibly damaging	0.52
R1758:Muc5ac	UTSW	7	141801531	missense	possibly damaging	0.86
R1837:Muc5ac	UTSW	7	141807086	missense	probably benign	0.00
R1911:Muc5ac	UTSW	7	141796304	missense	probably benign	0.18
R1922:Muc5ac	UTSW	7	141793689	missense	probably benign	0.03
R1966:Muc5ac	UTSW	7	141803376	missense	possibly damaging	0.92
R1994:Muc5ac	UTSW	7	141813152	missense	possibly damaging	0.93
R2056:Muc5ac	UTSW	7	141792035	missense	probably benign	0.01
R2126:Muc5ac	UTSW	7	141810742	missense	possibly damaging	0.84
R2170:Muc5ac	UTSW	7	141812347	missense	possibly damaging	0.93
R2258:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2259:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2293:Muc5ac	UTSW	7	141807199	missense	probably damaging	0.99
R2435:Muc5ac	UTSW	7	141818104	missense	possibly damaging	0.53
R2895:Muc5ac	UTSW	7	141791140	missense	possibly damaging	0.92
R2910:Muc5ac	UTSW	7	141807641	missense	probably damaging	0.99
R3154:Muc5ac	UTSW	7	141792736	splice site	probably null
R3762:Muc5ac	UTSW	7	141807475	missense	possibly damaging	0.53
R3791:Muc5ac	UTSW	7	141798501	missense	probably benign	0.32
R3806:Muc5ac	UTSW	7	141813734	missense	possibly damaging	0.91
R3825:Muc5ac	UTSW	7	141814723	missense	possibly damaging	0.92
R3888:Muc5ac	UTSW	7	141791224	missense	possibly damaging	0.51
R3929:Muc5ac	UTSW	7	141802892	missense	probably benign
R3981:Muc5ac	UTSW	7	141813775	missense	possibly damaging	0.86
R4034:Muc5ac	UTSW	7	141799844	critical splice donor site	probably null
R4043:Muc5ac	UTSW	7	141807478	missense	possibly damaging	0.53
R4061:Muc5ac	UTSW	7	141811130	missense	possibly damaging	0.85
R4106:Muc5ac	UTSW	7	141802835	missense	possibly damaging	0.86
R4206:Muc5ac	UTSW	7	141817110	missense	possibly damaging	0.73
R4613:Muc5ac	UTSW	7	141791103	missense	possibly damaging	0.93
R4719:Muc5ac	UTSW	7	141789763	missense	possibly damaging	0.83
R4751:Muc5ac	UTSW	7	141817601	missense	probably benign	0.00
R4789:Muc5ac	UTSW	7	141798882	missense	possibly damaging	0.86
R4928:Muc5ac	UTSW	7	141817902	nonsense	probably null
R4971:Muc5ac	UTSW	7	141816278	missense	possibly damaging	0.68
R4982:Muc5ac	UTSW	7	141809456	intron	probably benign
R5088:Muc5ac	UTSW	7	141796319	missense	possibly damaging	0.53
R5141:Muc5ac	UTSW	7	141814742	missense	possibly damaging	0.72
R5224:Muc5ac	UTSW	7	141793971	missense	probably benign	0.32
R5366:Muc5ac	UTSW	7	141807550	missense	probably benign	0.01
R5497:Muc5ac	UTSW	7	141807643	missense	probably damaging	0.99
R5507:Muc5ac	UTSW	7	141807832	missense	possibly damaging	0.72
R5643:Muc5ac	UTSW	7	141793715	critical splice donor site	probably null
R5811:Muc5ac	UTSW	7	141798984	missense	possibly damaging	0.51
R5946:Muc5ac	UTSW	7	141817907	missense	possibly damaging	0.73
R5970:Muc5ac	UTSW	7	141790669	nonsense	probably null
R5977:Muc5ac	UTSW	7	141796367	missense	possibly damaging	0.73
R6051:Muc5ac	UTSW	7	141811857	missense	possibly damaging	0.53
R6126:Muc5ac	UTSW	7	141801232	missense	possibly damaging	0.71
R6159:Muc5ac	UTSW	7	141815586	missense	possibly damaging	0.53
R6256:Muc5ac	UTSW	7	141789795	missense	possibly damaging	0.53
R6283:Muc5ac	UTSW	7	141816864	nonsense	probably null
R6341:Muc5ac	UTSW	7	141801492	missense	probably damaging	0.99
R6356:Muc5ac	UTSW	7	141812679	missense	probably benign	0.05
R6481:Muc5ac	UTSW	7	141809071	intron	probably benign
R6483:Muc5ac	UTSW	7	141802854	missense	probably benign	0.18
R6627:Muc5ac	UTSW	7	141808690	intron	probably benign
R6636:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6637:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6656:Muc5ac	UTSW	7	141803328	missense	probably damaging	0.98
R6721:Muc5ac	UTSW	7	141798992	missense	possibly damaging	0.71
R6794:Muc5ac	UTSW	7	141809552	intron	probably benign
R6844:Muc5ac	UTSW	7	141809744	intron	probably benign
R6847:Muc5ac	UTSW	7	141809744	intron	probably benign
R6852:Muc5ac	UTSW	7	141816907	missense	probably benign	0.03
R6862:Muc5ac	UTSW	7	141809744	intron	probably benign
R6863:Muc5ac	UTSW	7	141809744	intron	probably benign
R6864:Muc5ac	UTSW	7	141809744	intron	probably benign
R6865:Muc5ac	UTSW	7	141809744	intron	probably benign
R6874:Muc5ac	UTSW	7	141809744	intron	probably benign
R6875:Muc5ac	UTSW	7	141809744	intron	probably benign
R6876:Muc5ac	UTSW	7	141809744	intron	probably benign
R6877:Muc5ac	UTSW	7	141809744	intron	probably benign
R6889:Muc5ac	UTSW	7	141809744	intron	probably benign
R6920:Muc5ac	UTSW	7	141793298	missense	possibly damaging	0.86
R6998:Muc5ac	UTSW	7	141818714	missense	possibly damaging	0.92
R7017:Muc5ac	UTSW	7	141809687	intron	probably benign
R7091:Muc5ac	UTSW	7	141809687	intron	probably benign
R7092:Muc5ac	UTSW	7	141809648	intron	probably benign
R7092:Muc5ac	UTSW	7	141809687	intron	probably benign
R7110:Muc5ac	UTSW	7	141799822	missense	possibly damaging	0.95
R7117:Muc5ac	UTSW	7	141813822	nonsense	probably null
R7238:Muc5ac	UTSW	7	141809517	missense	unknown
R7238:Muc5ac	UTSW	7	141809687	intron	probably benign
R7396:Muc5ac	UTSW	7	141808415	missense	unknown
R7456:Muc5ac	UTSW	7	141793167	missense	probably benign	0.32
R7477:Muc5ac	UTSW	7	141816282	missense	possibly damaging	0.72
R7530:Muc5ac	UTSW	7	141813799	missense	possibly damaging	0.51
R7545:Muc5ac	UTSW	7	141808668	missense	unknown
R7604:Muc5ac	UTSW	7	141809709	missense	unknown
R7635:Muc5ac	UTSW	7	141805676	missense	probably damaging	0.98
R7635:Muc5ac	UTSW	7	141805753	missense	possibly damaging	0.53
R7650:Muc5ac	UTSW	7	141809422	missense	unknown
R7651:Muc5ac	UTSW	7	141796254	missense	possibly damaging	0.92
R7685:Muc5ac	UTSW	7	141809383	missense	unknown
R7720:Muc5ac	UTSW	7	141809303	missense	unknown
R7749:Muc5ac	UTSW	7	141809303	missense	unknown
R7750:Muc5ac	UTSW	7	141809303	missense	unknown
R7751:Muc5ac	UTSW	7	141809303	missense	unknown
R7754:Muc5ac	UTSW	7	141809303	missense	unknown
R7798:Muc5ac	UTSW	7	141794041	critical splice donor site	probably null
R7835:Muc5ac	UTSW	7	141809303	missense	unknown
R7837:Muc5ac	UTSW	7	141815963	missense	possibly damaging	0.53
R7858:Muc5ac	UTSW	7	141803429	missense	possibly damaging	0.51
R7866:Muc5ac	UTSW	7	141795852	missense	probably benign	0.00
R7874:Muc5ac	UTSW	7	141809303	missense	unknown
R7876:Muc5ac	UTSW	7	141809303	missense	unknown
R7877:Muc5ac	UTSW	7	141809303	missense	unknown
R7881:Muc5ac	UTSW	7	141809303	missense	unknown
R7884:Muc5ac	UTSW	7	141809303	missense	unknown
R7921:Muc5ac	UTSW	7	141809687	intron	probably benign
R7976:Muc5ac	UTSW	7	141809791	missense	unknown
R8104:Muc5ac	UTSW	7	141804783	missense	possibly damaging	0.96
R8177:Muc5ac	UTSW	7	141807331	missense	probably damaging	1.00
R8214:Muc5ac	UTSW	7	141802948	missense	possibly damaging	0.53
R8292:Muc5ac	UTSW	7	141809263	missense	unknown
R8386:Muc5ac	UTSW	7	141807634	missense	possibly damaging	0.93
R8400:Muc5ac	UTSW	7	141810476	missense	probably damaging	0.99
R8504:Muc5ac	UTSW	7	141807155	missense	probably damaging	1.00
X0060:Muc5ac	UTSW	7	141803333	missense	possibly damaging	0.71
Z1088:Muc5ac	UTSW	7	141809744	intron	probably benign
Z1088:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
Z1177:Muc5ac	UTSW	7	141809224	missense	unknown
Z1177:Muc5ac	UTSW	7	141818040	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- ACCTTCAAGCTCTGCCATGACG -3'
(R):5'- CAGCCATTGCTGAGTACTGACACC -3'

Sequencing Primer
(F):5'- GCCTAGAGCTCTATGCATCAC -3'
(R):5'- acccgcaaccataaaattattcc -3'

Posted On

2014-03-28