Incidental Mutation 'R1484:Muc5ac'
ID 163318
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
MMRRC Submission 039537-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1484 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 141342709-141372968 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 141367629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000041924
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155534
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163321
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,684,776 (GRCm39) noncoding transcript Het
Acvr1 A T 2: 58,369,901 (GRCm39) V36E probably damaging Het
Aldh4a1 A G 4: 139,370,758 (GRCm39) I414V probably benign Het
Alox5 C T 6: 116,431,128 (GRCm39) C100Y probably damaging Het
Ano5 T A 7: 51,216,068 (GRCm39) D348E probably damaging Het
Arhgap30 G A 1: 171,230,839 (GRCm39) V199M probably damaging Het
Arl13b T A 16: 62,626,999 (GRCm39) Q234L probably benign Het
Atxn1 C A 13: 45,711,052 (GRCm39) E627* probably null Het
Bend3 T C 10: 43,386,197 (GRCm39) F197L probably benign Het
Brca1 A T 11: 101,420,638 (GRCm39) V190E possibly damaging Het
Brpf1 T C 6: 113,292,096 (GRCm39) W381R probably damaging Het
Brwd1 A C 16: 95,829,491 (GRCm39) probably null Het
C1s2 T C 6: 124,602,604 (GRCm39) I530V possibly damaging Het
C2cd3 C T 7: 100,089,397 (GRCm39) R1638W probably damaging Het
Capns1 T A 7: 29,893,511 (GRCm39) probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cep126 G A 9: 8,100,554 (GRCm39) T660I possibly damaging Het
Cep295 A C 9: 15,246,080 (GRCm39) I744R probably damaging Het
Chd3 T C 11: 69,250,725 (GRCm39) E668G probably benign Het
Chek2 A G 5: 110,996,553 (GRCm39) T172A probably damaging Het
Col6a4 A G 9: 105,890,501 (GRCm39) probably null Het
Coq3 G A 4: 21,900,291 (GRCm39) V173I probably benign Het
Cyp4x1 A T 4: 114,970,098 (GRCm39) I343N probably damaging Het
Dnah7b T A 1: 46,176,703 (GRCm39) D774E probably benign Het
Dnai3 T C 3: 145,802,996 (GRCm39) D65G probably benign Het
Ecm1 G A 3: 95,643,275 (GRCm39) R342C probably damaging Het
Esrra T C 19: 6,890,197 (GRCm39) Y209C probably damaging Het
Gpr149 A T 3: 62,502,592 (GRCm39) D421E probably benign Het
Gpr15 T C 16: 58,538,937 (GRCm39) N51D probably damaging Het
Gpr156 T C 16: 37,812,558 (GRCm39) V298A probably damaging Het
Hmcn2 G A 2: 31,236,507 (GRCm39) G350D probably damaging Het
Ifih1 A T 2: 62,440,902 (GRCm39) N421K probably benign Het
Ilvbl C A 10: 78,412,564 (GRCm39) T95K probably damaging Het
Itgb4 T A 11: 115,890,625 (GRCm39) D1104E probably benign Het
Katnip C A 7: 125,415,743 (GRCm39) probably benign Het
Lipf A T 19: 33,942,180 (GRCm39) M37L probably benign Het
Lyst T A 13: 13,852,775 (GRCm39) N2258K probably benign Het
Moxd1 A G 10: 24,099,758 (GRCm39) Y86C probably damaging Het
Myo16 G A 8: 10,610,145 (GRCm39) R1162H probably damaging Het
Myo5c A T 9: 75,208,092 (GRCm39) N1609Y probably damaging Het
Nbeal1 T C 1: 60,240,098 (GRCm39) F155L probably damaging Het
Nek4 A T 14: 30,704,290 (GRCm39) M602L possibly damaging Het
Nek9 A G 12: 85,348,622 (GRCm39) S971P probably damaging Het
Nfya A T 17: 48,700,570 (GRCm39) probably benign Het
Nrxn3 A T 12: 89,221,547 (GRCm39) N442I probably damaging Het
Nup42 A C 5: 24,383,075 (GRCm39) K200N probably benign Het
Or1e26 T A 11: 73,480,187 (GRCm39) I126L possibly damaging Het
Or4c111 G A 2: 88,843,713 (GRCm39) R232* probably null Het
Or7g32 G A 9: 19,389,423 (GRCm39) T38I probably damaging Het
Pcdh15 T A 10: 74,126,833 (GRCm39) I304N probably damaging Het
Pigo G C 4: 43,024,779 (GRCm39) P107A probably damaging Het
Plce1 C T 19: 38,693,783 (GRCm39) Q769* probably null Het
Plin2 C T 4: 86,575,481 (GRCm39) R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 (GRCm39) E739* probably null Het
Ppp3cc G T 14: 70,478,397 (GRCm39) N268K probably damaging Het
Prkag3 T A 1: 74,779,919 (GRCm39) D472V probably damaging Het
Ptch2 A T 4: 116,968,046 (GRCm39) D846V probably damaging Het
Rhob A T 12: 8,549,388 (GRCm39) M82K probably damaging Het
Rps6kc1 T A 1: 190,531,672 (GRCm39) R777W possibly damaging Het
Sap130 T A 18: 31,844,380 (GRCm39) V850E probably damaging Het
Sema3a T G 5: 13,523,407 (GRCm39) N125K probably damaging Het
Sema5a A G 15: 32,460,431 (GRCm39) D64G probably damaging Het
Sgo2b T A 8: 64,384,507 (GRCm39) D163V possibly damaging Het
Slc15a1 A T 14: 121,728,651 (GRCm39) Y31* probably null Het
Smchd1 A T 17: 71,685,252 (GRCm39) M1392K probably benign Het
Sobp T A 10: 43,036,827 (GRCm39) N37I probably damaging Het
Spock3 G T 8: 63,673,739 (GRCm39) C142F probably damaging Het
Stx6 A C 1: 155,053,650 (GRCm39) S86R probably benign Het
Sult2a4 C A 7: 13,643,726 (GRCm39) M280I probably benign Het
Synm A T 7: 67,386,080 (GRCm39) D527E probably damaging Het
Tax1bp1 C T 6: 52,710,305 (GRCm39) R195W probably damaging Het
Themis2 A T 4: 132,519,796 (GRCm39) N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 (GRCm39) T890A probably benign Het
Traf7 T A 17: 24,730,785 (GRCm39) H366L possibly damaging Het
Trim30c A T 7: 104,032,459 (GRCm39) V289D probably benign Het
Tsr1 T A 11: 74,792,914 (GRCm39) D407E probably damaging Het
Ubap2 G T 4: 41,235,593 (GRCm39) A33E probably damaging Het
Unc13d C A 11: 115,964,701 (GRCm39) R255L possibly damaging Het
Ush2a G T 1: 188,542,534 (GRCm39) G3367* probably null Het
Vmn1r229 T C 17: 21,034,791 (GRCm39) L12P probably damaging Het
Vmn2r27 C A 6: 124,177,474 (GRCm39) G510V probably damaging Het
Vps4b T C 1: 106,707,712 (GRCm39) E257G probably damaging Het
Vps72 T C 3: 95,026,462 (GRCm39) S136P probably damaging Het
Wdr36 T C 18: 32,976,938 (GRCm39) I181T possibly damaging Het
Wfikkn1 C T 17: 26,096,765 (GRCm39) A520T probably benign Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141,366,440 (GRCm39) missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141,361,210 (GRCm39) missense probably benign 0.12
IGL01155:Muc5ac APN 7 141,360,680 (GRCm39) splice site probably benign
IGL01452:Muc5ac APN 7 141,371,292 (GRCm39) missense probably benign 0.00
IGL01590:Muc5ac APN 7 141,352,630 (GRCm39) missense probably benign 0.02
IGL02104:Muc5ac APN 7 141,364,815 (GRCm39) missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141,353,914 (GRCm39) missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141,372,537 (GRCm39) nonsense probably null
IGL02178:Muc5ac APN 7 141,359,184 (GRCm39) splice site probably benign
IGL02403:Muc5ac APN 7 141,357,187 (GRCm39) missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141,370,781 (GRCm39) missense probably benign 0.01
IGL02665:Muc5ac APN 7 141,344,823 (GRCm39) missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141,349,000 (GRCm39) missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141,359,512 (GRCm39) missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141,367,518 (GRCm39) missense probably benign 0.34
IGL03384:Muc5ac APN 7 141,366,140 (GRCm39) missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141,348,950 (GRCm39) missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141,361,153 (GRCm39) missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141,372,367 (GRCm39) missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141,349,012 (GRCm39) missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141,364,776 (GRCm39) missense probably benign 0.08
R0363:Muc5ac UTSW 7 141,354,697 (GRCm39) missense probably benign 0.01
R0384:Muc5ac UTSW 7 141,365,988 (GRCm39) missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141,345,771 (GRCm39) nonsense probably null
R0583:Muc5ac UTSW 7 141,361,345 (GRCm39) missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141,349,981 (GRCm39) missense probably benign 0.02
R0682:Muc5ac UTSW 7 141,359,406 (GRCm39) missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141,361,446 (GRCm39) missense probably benign 0.03
R0883:Muc5ac UTSW 7 141,350,002 (GRCm39) missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141,361,252 (GRCm39) missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141,370,666 (GRCm39) missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141,361,060 (GRCm39) missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141,361,114 (GRCm39) missense probably damaging 0.99
R1599:Muc5ac UTSW 7 141,352,640 (GRCm39) missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141,355,268 (GRCm39) missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141,360,823 (GRCm39) missense probably benign 0.00
R1911:Muc5ac UTSW 7 141,350,041 (GRCm39) missense probably benign 0.18
R1922:Muc5ac UTSW 7 141,347,426 (GRCm39) missense probably benign 0.03
R1966:Muc5ac UTSW 7 141,357,113 (GRCm39) missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141,366,889 (GRCm39) missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141,345,772 (GRCm39) missense probably benign 0.01
R2126:Muc5ac UTSW 7 141,364,479 (GRCm39) missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141,366,084 (GRCm39) missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2259:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2293:Muc5ac UTSW 7 141,360,936 (GRCm39) missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141,371,841 (GRCm39) missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141,344,877 (GRCm39) missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141,361,378 (GRCm39) missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141,346,473 (GRCm39) splice site probably null
R3762:Muc5ac UTSW 7 141,361,212 (GRCm39) missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141,352,238 (GRCm39) missense probably benign 0.32
R3806:Muc5ac UTSW 7 141,367,471 (GRCm39) missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141,368,460 (GRCm39) missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141,344,961 (GRCm39) missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141,356,629 (GRCm39) missense probably benign
R3981:Muc5ac UTSW 7 141,367,512 (GRCm39) missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141,353,581 (GRCm39) critical splice donor site probably null
R4043:Muc5ac UTSW 7 141,361,215 (GRCm39) missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141,364,867 (GRCm39) missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141,356,572 (GRCm39) missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141,370,847 (GRCm39) missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141,344,840 (GRCm39) missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141,343,500 (GRCm39) missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141,371,338 (GRCm39) missense probably benign 0.00
R4789:Muc5ac UTSW 7 141,352,619 (GRCm39) missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141,371,639 (GRCm39) nonsense probably null
R4971:Muc5ac UTSW 7 141,370,015 (GRCm39) missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141,363,193 (GRCm39) intron probably benign
R5088:Muc5ac UTSW 7 141,350,056 (GRCm39) missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141,368,479 (GRCm39) missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141,347,708 (GRCm39) missense probably benign 0.32
R5366:Muc5ac UTSW 7 141,361,287 (GRCm39) missense probably benign 0.01
R5497:Muc5ac UTSW 7 141,361,380 (GRCm39) missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141,361,569 (GRCm39) missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141,347,452 (GRCm39) critical splice donor site probably null
R5811:Muc5ac UTSW 7 141,352,721 (GRCm39) missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141,371,644 (GRCm39) missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141,344,406 (GRCm39) nonsense probably null
R5977:Muc5ac UTSW 7 141,350,104 (GRCm39) missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141,365,594 (GRCm39) missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141,354,969 (GRCm39) missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141,369,323 (GRCm39) missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141,343,532 (GRCm39) missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141,370,601 (GRCm39) nonsense probably null
R6341:Muc5ac UTSW 7 141,355,229 (GRCm39) missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141,366,416 (GRCm39) missense probably benign 0.05
R6481:Muc5ac UTSW 7 141,362,808 (GRCm39) intron probably benign
R6483:Muc5ac UTSW 7 141,356,591 (GRCm39) missense probably benign 0.18
R6627:Muc5ac UTSW 7 141,362,427 (GRCm39) intron probably benign
R6636:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141,357,065 (GRCm39) missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141,352,729 (GRCm39) missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141,363,289 (GRCm39) intron probably benign
R6844:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6847:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6852:Muc5ac UTSW 7 141,370,644 (GRCm39) missense probably benign 0.03
R6862:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6863:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6864:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6865:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6874:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6875:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6876:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6877:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6889:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6920:Muc5ac UTSW 7 141,347,035 (GRCm39) missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141,372,451 (GRCm39) missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7091:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,385 (GRCm39) intron probably benign
R7110:Muc5ac UTSW 7 141,353,559 (GRCm39) missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141,367,559 (GRCm39) nonsense probably null
R7238:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7238:Muc5ac UTSW 7 141,363,254 (GRCm39) missense unknown
R7396:Muc5ac UTSW 7 141,362,152 (GRCm39) missense unknown
R7456:Muc5ac UTSW 7 141,346,904 (GRCm39) missense probably benign 0.32
R7477:Muc5ac UTSW 7 141,370,019 (GRCm39) missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141,367,536 (GRCm39) missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141,362,405 (GRCm39) missense unknown
R7604:Muc5ac UTSW 7 141,363,446 (GRCm39) missense unknown
R7635:Muc5ac UTSW 7 141,359,413 (GRCm39) missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141,359,490 (GRCm39) missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141,363,159 (GRCm39) missense unknown
R7651:Muc5ac UTSW 7 141,349,991 (GRCm39) missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141,363,120 (GRCm39) missense unknown
R7720:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7749:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7750:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7751:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7754:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7798:Muc5ac UTSW 7 141,347,778 (GRCm39) critical splice donor site probably null
R7835:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7837:Muc5ac UTSW 7 141,369,700 (GRCm39) missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141,357,166 (GRCm39) missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141,349,589 (GRCm39) missense probably benign 0.00
R7874:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7876:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7877:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7881:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7884:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7921:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7976:Muc5ac UTSW 7 141,363,528 (GRCm39) missense unknown
R8104:Muc5ac UTSW 7 141,358,520 (GRCm39) missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141,361,068 (GRCm39) missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141,356,685 (GRCm39) missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141,363,000 (GRCm39) missense unknown
R8386:Muc5ac UTSW 7 141,361,371 (GRCm39) missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141,364,213 (GRCm39) missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141,360,892 (GRCm39) missense probably damaging 1.00
R8709:Muc5ac UTSW 7 141,370,663 (GRCm39) missense possibly damaging 0.96
R8725:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8727:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8754:Muc5ac UTSW 7 141,354,008 (GRCm39) missense possibly damaging 0.85
R8769:Muc5ac UTSW 7 141,372,609 (GRCm39) missense probably damaging 1.00
R8933:Muc5ac UTSW 7 141,343,493 (GRCm39) missense possibly damaging 0.59
R8939:Muc5ac UTSW 7 141,347,091 (GRCm39) missense probably damaging 0.98
R9049:Muc5ac UTSW 7 141,362,712 (GRCm39) missense unknown
R9124:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9131:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9132:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9135:Muc5ac UTSW 7 141,352,218 (GRCm39) missense probably damaging 0.99
R9156:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9157:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9159:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9160:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9161:Muc5ac UTSW 7 141,353,026 (GRCm39) missense possibly damaging 0.53
R9175:Muc5ac UTSW 7 141,366,093 (GRCm39) missense possibly damaging 0.92
R9183:Muc5ac UTSW 7 141,352,637 (GRCm39) missense possibly damaging 0.71
R9218:Muc5ac UTSW 7 141,361,098 (GRCm39) missense probably damaging 0.99
R9219:Muc5ac UTSW 7 141,370,800 (GRCm39) nonsense probably null
R9239:Muc5ac UTSW 7 141,353,954 (GRCm39) missense probably damaging 0.99
R9246:Muc5ac UTSW 7 141,364,215 (GRCm39) missense probably benign 0.11
R9287:Muc5ac UTSW 7 141,361,626 (GRCm39) missense probably damaging 0.99
R9320:Muc5ac UTSW 7 141,369,255 (GRCm39) missense probably benign 0.01
R9327:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
R9428:Muc5ac UTSW 7 141,362,559 (GRCm39) missense unknown
R9430:Muc5ac UTSW 7 141,362,569 (GRCm39) missense unknown
R9454:Muc5ac UTSW 7 141,362,431 (GRCm39) missense unknown
R9483:Muc5ac UTSW 7 141,365,465 (GRCm39) nonsense probably null
R9581:Muc5ac UTSW 7 141,363,799 (GRCm39) missense unknown
R9610:Muc5ac UTSW 7 141,350,078 (GRCm39) missense possibly damaging 0.86
R9642:Muc5ac UTSW 7 141,349,601 (GRCm39) missense possibly damaging 0.71
R9684:Muc5ac UTSW 7 141,364,798 (GRCm39) missense probably benign 0.41
R9760:Muc5ac UTSW 7 141,360,985 (GRCm39) missense probably benign 0.05
R9778:Muc5ac UTSW 7 141,349,021 (GRCm39) nonsense probably null
X0060:Muc5ac UTSW 7 141,357,070 (GRCm39) missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
Z1088:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
Z1177:Muc5ac UTSW 7 141,371,777 (GRCm39) missense probably benign 0.33
Z1177:Muc5ac UTSW 7 141,362,961 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACCTTCAAGCTCTGCCATGACG -3'
(R):5'- CAGCCATTGCTGAGTACTGACACC -3'

Sequencing Primer
(F):5'- GCCTAGAGCTCTATGCATCAC -3'
(R):5'- acccgcaaccataaaattattcc -3'
Posted On 2014-03-28