Mutagenetix > Incidental Mutation

Incidental Mutation 'R1484:Chd3'

163333

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1

MMRRC Submission

039537-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1484 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69234099-69260232 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69250725 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 668 (E668G)

Ref Sequence

ENSEMBL: ENSMUSP00000104301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]

AlphaFold

B1AR17

Predicted Effect

probably benign
Transcript: ENSMUST00000092971
AA Change: E668G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: E668G

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108661
AA Change: E668G

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: E668G

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000128981
AA Change: E574G

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: E574G

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144701

SMART Domains

Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	23	32	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
PHD	84	127	1.54e-14	SMART
RING	85	126	4.25e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151436

SMART Domains

Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	142	9e-24	PFAM
SCOP:d1gkub2	162	197	1e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154046

SMART Domains

Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
low complexity region	1	29	N/A	INTRINSIC
low complexity region	50	66	N/A	INTRINSIC
PHD	86	129	1.54e-14	SMART
RING	87	128	4.25e-1	SMART

Meta Mutation Damage Score

0.0948

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

97% (85/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	T	5: 26,684,776 (GRCm39)		noncoding transcript	Het
Acvr1	A	T	2: 58,369,901 (GRCm39)	V36E	probably damaging	Het
Aldh4a1	A	G	4: 139,370,758 (GRCm39)	I414V	probably benign	Het
Alox5	C	T	6: 116,431,128 (GRCm39)	C100Y	probably damaging	Het
Ano5	T	A	7: 51,216,068 (GRCm39)	D348E	probably damaging	Het
Arhgap30	G	A	1: 171,230,839 (GRCm39)	V199M	probably damaging	Het
Arl13b	T	A	16: 62,626,999 (GRCm39)	Q234L	probably benign	Het
Atxn1	C	A	13: 45,711,052 (GRCm39)	E627*	probably null	Het
Bend3	T	C	10: 43,386,197 (GRCm39)	F197L	probably benign	Het
Brca1	A	T	11: 101,420,638 (GRCm39)	V190E	possibly damaging	Het
Brpf1	T	C	6: 113,292,096 (GRCm39)	W381R	probably damaging	Het
Brwd1	A	C	16: 95,829,491 (GRCm39)		probably null	Het
C1s2	T	C	6: 124,602,604 (GRCm39)	I530V	possibly damaging	Het
C2cd3	C	T	7: 100,089,397 (GRCm39)	R1638W	probably damaging	Het
Capns1	T	A	7: 29,893,511 (GRCm39)		probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,619,782 (GRCm39)		probably benign	Het
Cep126	G	A	9: 8,100,554 (GRCm39)	T660I	possibly damaging	Het
Cep295	A	C	9: 15,246,080 (GRCm39)	I744R	probably damaging	Het
Chek2	A	G	5: 110,996,553 (GRCm39)	T172A	probably damaging	Het
Col6a4	A	G	9: 105,890,501 (GRCm39)		probably null	Het
Coq3	G	A	4: 21,900,291 (GRCm39)	V173I	probably benign	Het
Cyp4x1	A	T	4: 114,970,098 (GRCm39)	I343N	probably damaging	Het
Dnah7b	T	A	1: 46,176,703 (GRCm39)	D774E	probably benign	Het
Dnai3	T	C	3: 145,802,996 (GRCm39)	D65G	probably benign	Het
Ecm1	G	A	3: 95,643,275 (GRCm39)	R342C	probably damaging	Het
Esrra	T	C	19: 6,890,197 (GRCm39)	Y209C	probably damaging	Het
Gpr149	A	T	3: 62,502,592 (GRCm39)	D421E	probably benign	Het
Gpr15	T	C	16: 58,538,937 (GRCm39)	N51D	probably damaging	Het
Gpr156	T	C	16: 37,812,558 (GRCm39)	V298A	probably damaging	Het
Hmcn2	G	A	2: 31,236,507 (GRCm39)	G350D	probably damaging	Het
Ifih1	A	T	2: 62,440,902 (GRCm39)	N421K	probably benign	Het
Ilvbl	C	A	10: 78,412,564 (GRCm39)	T95K	probably damaging	Het
Itgb4	T	A	11: 115,890,625 (GRCm39)	D1104E	probably benign	Het
Katnip	C	A	7: 125,415,743 (GRCm39)		probably benign	Het
Lipf	A	T	19: 33,942,180 (GRCm39)	M37L	probably benign	Het
Lyst	T	A	13: 13,852,775 (GRCm39)	N2258K	probably benign	Het
Moxd1	A	G	10: 24,099,758 (GRCm39)	Y86C	probably damaging	Het
Muc5ac	T	C	7: 141,367,629 (GRCm39)		probably null	Het
Myo16	G	A	8: 10,610,145 (GRCm39)	R1162H	probably damaging	Het
Myo5c	A	T	9: 75,208,092 (GRCm39)	N1609Y	probably damaging	Het
Nbeal1	T	C	1: 60,240,098 (GRCm39)	F155L	probably damaging	Het
Nek4	A	T	14: 30,704,290 (GRCm39)	M602L	possibly damaging	Het
Nek9	A	G	12: 85,348,622 (GRCm39)	S971P	probably damaging	Het
Nfya	A	T	17: 48,700,570 (GRCm39)		probably benign	Het
Nrxn3	A	T	12: 89,221,547 (GRCm39)	N442I	probably damaging	Het
Nup42	A	C	5: 24,383,075 (GRCm39)	K200N	probably benign	Het
Or1e26	T	A	11: 73,480,187 (GRCm39)	I126L	possibly damaging	Het
Or4c111	G	A	2: 88,843,713 (GRCm39)	R232*	probably null	Het
Or7g32	G	A	9: 19,389,423 (GRCm39)	T38I	probably damaging	Het
Pcdh15	T	A	10: 74,126,833 (GRCm39)	I304N	probably damaging	Het
Pigo	G	C	4: 43,024,779 (GRCm39)	P107A	probably damaging	Het
Plce1	C	T	19: 38,693,783 (GRCm39)	Q769*	probably null	Het
Plin2	C	T	4: 86,575,481 (GRCm39)	R356H	probably benign	Het
Ppp1r9a	G	T	6: 5,113,712 (GRCm39)	E739*	probably null	Het
Ppp3cc	G	T	14: 70,478,397 (GRCm39)	N268K	probably damaging	Het
Prkag3	T	A	1: 74,779,919 (GRCm39)	D472V	probably damaging	Het
Ptch2	A	T	4: 116,968,046 (GRCm39)	D846V	probably damaging	Het
Rhob	A	T	12: 8,549,388 (GRCm39)	M82K	probably damaging	Het
Rps6kc1	T	A	1: 190,531,672 (GRCm39)	R777W	possibly damaging	Het
Sap130	T	A	18: 31,844,380 (GRCm39)	V850E	probably damaging	Het
Sema3a	T	G	5: 13,523,407 (GRCm39)	N125K	probably damaging	Het
Sema5a	A	G	15: 32,460,431 (GRCm39)	D64G	probably damaging	Het
Sgo2b	T	A	8: 64,384,507 (GRCm39)	D163V	possibly damaging	Het
Slc15a1	A	T	14: 121,728,651 (GRCm39)	Y31*	probably null	Het
Smchd1	A	T	17: 71,685,252 (GRCm39)	M1392K	probably benign	Het
Sobp	T	A	10: 43,036,827 (GRCm39)	N37I	probably damaging	Het
Spock3	G	T	8: 63,673,739 (GRCm39)	C142F	probably damaging	Het
Stx6	A	C	1: 155,053,650 (GRCm39)	S86R	probably benign	Het
Sult2a4	C	A	7: 13,643,726 (GRCm39)	M280I	probably benign	Het
Synm	A	T	7: 67,386,080 (GRCm39)	D527E	probably damaging	Het
Tax1bp1	C	T	6: 52,710,305 (GRCm39)	R195W	probably damaging	Het
Themis2	A	T	4: 132,519,796 (GRCm39)	N76K	possibly damaging	Het
Tmem8b	A	G	4: 43,690,234 (GRCm39)	T890A	probably benign	Het
Traf7	T	A	17: 24,730,785 (GRCm39)	H366L	possibly damaging	Het
Trim30c	A	T	7: 104,032,459 (GRCm39)	V289D	probably benign	Het
Tsr1	T	A	11: 74,792,914 (GRCm39)	D407E	probably damaging	Het
Ubap2	G	T	4: 41,235,593 (GRCm39)	A33E	probably damaging	Het
Unc13d	C	A	11: 115,964,701 (GRCm39)	R255L	possibly damaging	Het
Ush2a	G	T	1: 188,542,534 (GRCm39)	G3367*	probably null	Het
Vmn1r229	T	C	17: 21,034,791 (GRCm39)	L12P	probably damaging	Het
Vmn2r27	C	A	6: 124,177,474 (GRCm39)	G510V	probably damaging	Het
Vps4b	T	C	1: 106,707,712 (GRCm39)	E257G	probably damaging	Het
Vps72	T	C	3: 95,026,462 (GRCm39)	S136P	probably damaging	Het
Wdr36	T	C	18: 32,976,938 (GRCm39)	I181T	possibly damaging	Het
Wfikkn1	C	T	17: 26,096,765 (GRCm39)	A520T	probably benign	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69,247,888 (GRCm39)	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69,237,455 (GRCm39)	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69,248,209 (GRCm39)	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69,240,697 (GRCm39)	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69,250,791 (GRCm39)	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69,248,557 (GRCm39)	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69,244,037 (GRCm39)	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69,250,806 (GRCm39)	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69,239,568 (GRCm39)	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69,249,060 (GRCm39)	unclassified	probably benign
IGL01635:Chd3	APN	11	69,252,076 (GRCm39)	splice site	probably benign
IGL01942:Chd3	APN	11	69,240,931 (GRCm39)	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69,248,319 (GRCm39)	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69,251,501 (GRCm39)	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69,251,886 (GRCm39)	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69,250,655 (GRCm39)	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69,242,920 (GRCm39)	unclassified	probably benign
IGL02415:Chd3	APN	11	69,239,739 (GRCm39)	splice site	probably benign
IGL02648:Chd3	APN	11	69,242,976 (GRCm39)	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69,251,874 (GRCm39)	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69,245,230 (GRCm39)	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69,252,022 (GRCm39)	nonsense	probably null
IGL03168:Chd3	APN	11	69,239,741 (GRCm39)	splice site	probably benign
IGL03327:Chd3	APN	11	69,241,012 (GRCm39)	missense	probably damaging	1.00
burg	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
castello	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
feste	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
Fortress	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
moat	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
Redoubt	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
schloss	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
siege	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69,250,739 (GRCm39)	unclassified	probably benign
R0129:Chd3	UTSW	11	69,239,327 (GRCm39)	nonsense	probably null
R0130:Chd3	UTSW	11	69,250,656 (GRCm39)	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69,247,159 (GRCm39)	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69,248,367 (GRCm39)	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69,244,931 (GRCm39)	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69,252,495 (GRCm39)	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69,236,313 (GRCm39)	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69,238,021 (GRCm39)	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69,248,400 (GRCm39)	splice site	probably null
R1741:Chd3	UTSW	11	69,246,480 (GRCm39)	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69,255,523 (GRCm39)	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
R1833:Chd3	UTSW	11	69,244,949 (GRCm39)	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69,239,878 (GRCm39)	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69,239,877 (GRCm39)	missense	probably benign
R2147:Chd3	UTSW	11	69,239,854 (GRCm39)	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69,251,471 (GRCm39)	missense	probably damaging	1.00
R2877:Chd3	UTSW	11	69,251,998 (GRCm39)	nonsense	probably null
R2879:Chd3	UTSW	11	69,254,924 (GRCm39)	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69,251,442 (GRCm39)	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69,252,973 (GRCm39)	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
R3845:Chd3	UTSW	11	69,237,585 (GRCm39)	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69,239,827 (GRCm39)	missense	probably benign
R4115:Chd3	UTSW	11	69,248,343 (GRCm39)	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69,240,703 (GRCm39)	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69,244,035 (GRCm39)	nonsense	probably null
R4622:Chd3	UTSW	11	69,239,834 (GRCm39)	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4635:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4859:Chd3	UTSW	11	69,250,722 (GRCm39)	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69,245,034 (GRCm39)	unclassified	probably benign
R5173:Chd3	UTSW	11	69,260,069 (GRCm39)	unclassified	probably benign
R5287:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5403:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5511:Chd3	UTSW	11	69,252,301 (GRCm39)	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69,244,177 (GRCm39)	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69,252,261 (GRCm39)	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69,242,944 (GRCm39)	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69,240,063 (GRCm39)	missense	probably benign
R6211:Chd3	UTSW	11	69,243,503 (GRCm39)	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69,236,361 (GRCm39)	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69,244,604 (GRCm39)	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69,252,510 (GRCm39)	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69,254,857 (GRCm39)	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69,243,371 (GRCm39)	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69,240,938 (GRCm39)	nonsense	probably null
R6548:Chd3	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
R6582:Chd3	UTSW	11	69,259,982 (GRCm39)	unclassified	probably benign
R6721:Chd3	UTSW	11	69,260,045 (GRCm39)	unclassified	probably benign
R6776:Chd3	UTSW	11	69,245,296 (GRCm39)	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69,260,027 (GRCm39)	missense	unknown
R7136:Chd3	UTSW	11	69,239,264 (GRCm39)	missense	probably null	0.37
R7164:Chd3	UTSW	11	69,253,132 (GRCm39)	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69,254,921 (GRCm39)	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69,260,037 (GRCm39)	missense	unknown
R7238:Chd3	UTSW	11	69,254,873 (GRCm39)	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69,236,394 (GRCm39)	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69,247,096 (GRCm39)	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69,248,692 (GRCm39)	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69,246,459 (GRCm39)	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69,244,064 (GRCm39)	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69,247,451 (GRCm39)	missense	probably benign	0.13
R8150:Chd3	UTSW	11	69,254,510 (GRCm39)	missense	probably benign	0.02
R8161:Chd3	UTSW	11	69,241,711 (GRCm39)	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69,251,483 (GRCm39)	missense	probably damaging	1.00
R8334:Chd3	UTSW	11	69,241,622 (GRCm39)	missense	probably damaging	1.00
R8423:Chd3	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
R8690:Chd3	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
R8828:Chd3	UTSW	11	69,247,097 (GRCm39)	missense	probably damaging	1.00
R8857:Chd3	UTSW	11	69,253,146 (GRCm39)	missense	probably benign	0.22
R9124:Chd3	UTSW	11	69,260,162 (GRCm39)	missense	unknown
R9170:Chd3	UTSW	11	69,241,648 (GRCm39)	missense	possibly damaging	0.64
R9213:Chd3	UTSW	11	69,255,628 (GRCm39)	missense	possibly damaging	0.53
R9285:Chd3	UTSW	11	69,249,954 (GRCm39)	missense	possibly damaging	0.64
R9293:Chd3	UTSW	11	69,244,027 (GRCm39)	missense	possibly damaging	0.94
R9368:Chd3	UTSW	11	69,251,200 (GRCm39)	missense	probably damaging	1.00
R9521:Chd3	UTSW	11	69,249,133 (GRCm39)	missense	probably benign	0.01
R9544:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
R9554:Chd3	UTSW	11	69,251,015 (GRCm39)	missense	probably damaging	1.00
R9588:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69,247,084 (GRCm39)	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
Z1186:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1186:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1187:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1187:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1188:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1188:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1189:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1189:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1190:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1190:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1191:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1191:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1192:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1192:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCTCAATCGGTCATTTGGCTTACG -3'
(R):5'- TCCTCTTCAAGGCAGATCAGAGCG -3'

Sequencing Primer
(F):5'- ACAGCAGTGTCATAGTCCAG -3'
(R):5'- GACTGTCCTACTGGCACTG -3'

Posted On

2014-03-28