Mutagenetix > Incidental Mutations

Incidental Mutation 'R1484:Brca1'

163336

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

039537-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1484 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101529812 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 190 (V190E)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000190862] [ENSMUST00000191198]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000017290
AA Change: V190E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: V190E

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188168

Predicted Effect

probably benign
Transcript: ENSMUST00000190862

SMART Domains

Protein: ENSMUSP00000139599
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
SCOP:d1jm7a_	1	56	1e-6	SMART
PDB:1JM7\|A	1	63	1e-30	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

97% (85/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	T	5: 26,479,778		noncoding transcript	Het
Acvr1	A	T	2: 58,479,889	V36E	probably damaging	Het
Aldh4a1	A	G	4: 139,643,447	I414V	probably benign	Het
Alox5	C	T	6: 116,454,167	C100Y	probably damaging	Het
Ano5	T	A	7: 51,566,320	D348E	probably damaging	Het
Arhgap30	G	A	1: 171,403,271	V199M	probably damaging	Het
Arl13b	T	A	16: 62,806,636	Q234L	probably benign	Het
Atxn1	C	A	13: 45,557,576	E627*	probably null	Het
Bend3	T	C	10: 43,510,201	F197L	probably benign	Het
Brpf1	T	C	6: 113,315,135	W381R	probably damaging	Het
Brwd1	A	C	16: 96,028,291		probably null	Het
C1s2	T	C	6: 124,625,645	I530V	possibly damaging	Het
C2cd3	C	T	7: 100,440,190	R1638W	probably damaging	Het
Capns1	T	A	7: 30,194,086		probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cep126	G	A	9: 8,100,553	T660I	possibly damaging	Het
Cep295	A	C	9: 15,334,784	I744R	probably damaging	Het
Chd3	T	C	11: 69,359,899	E668G	probably benign	Het
Chek2	A	G	5: 110,848,687	T172A	probably damaging	Het
Col6a4	A	G	9: 106,013,302		probably null	Het
Coq3	G	A	4: 21,900,291	V173I	probably benign	Het
Cyp4x1	A	T	4: 115,112,901	I343N	probably damaging	Het
D430042O09Rik	C	A	7: 125,816,571		probably benign	Het
Dnah7b	T	A	1: 46,137,543	D774E	probably benign	Het
Ecm1	G	A	3: 95,735,963	R342C	probably damaging	Het
Esrra	T	C	19: 6,912,829	Y209C	probably damaging	Het
Gpr149	A	T	3: 62,595,171	D421E	probably benign	Het
Gpr15	T	C	16: 58,718,574	N51D	probably damaging	Het
Gpr156	T	C	16: 37,992,196	V298A	probably damaging	Het
Hmcn2	G	A	2: 31,346,495	G350D	probably damaging	Het
Ifih1	A	T	2: 62,610,558	N421K	probably benign	Het
Ilvbl	C	A	10: 78,576,730	T95K	probably damaging	Het
Itgb4	T	A	11: 115,999,799	D1104E	probably benign	Het
Lipf	A	T	19: 33,964,780	M37L	probably benign	Het
Lyst	T	A	13: 13,678,190	N2258K	probably benign	Het
Moxd1	A	G	10: 24,223,860	Y86C	probably damaging	Het
Muc5ac	T	C	7: 141,813,892		probably null	Het
Myo16	G	A	8: 10,560,145	R1162H	probably damaging	Het
Myo5c	A	T	9: 75,300,810	N1609Y	probably damaging	Het
Nbeal1	T	C	1: 60,200,939	F155L	probably damaging	Het
Nek4	A	T	14: 30,982,333	M602L	possibly damaging	Het
Nek9	A	G	12: 85,301,848	S971P	probably damaging	Het
Nfya	A	T	17: 48,393,542		probably benign	Het
Nrxn3	A	T	12: 89,254,777	N442I	probably damaging	Het
Nupl2	A	C	5: 24,178,077	K200N	probably benign	Het
Olfr1216	G	A	2: 89,013,369	R232*	probably null	Het
Olfr385	T	A	11: 73,589,361	I126L	possibly damaging	Het
Olfr850	G	A	9: 19,478,127	T38I	probably damaging	Het
Pcdh15	T	A	10: 74,291,001	I304N	probably damaging	Het
Pigo	G	C	4: 43,024,779	P107A	probably damaging	Het
Plce1	C	T	19: 38,705,339	Q769*	probably null	Het
Plin2	C	T	4: 86,657,244	R356H	probably benign	Het
Ppp1r9a	G	T	6: 5,113,712	E739*	probably null	Het
Ppp3cc	G	T	14: 70,240,948	N268K	probably damaging	Het
Prkag3	T	A	1: 74,740,760	D472V	probably damaging	Het
Ptch2	A	T	4: 117,110,849	D846V	probably damaging	Het
Rhob	A	T	12: 8,499,388	M82K	probably damaging	Het
Rps6kc1	T	A	1: 190,799,475	R777W	possibly damaging	Het
Sap130	T	A	18: 31,711,327	V850E	probably damaging	Het
Sema3a	T	G	5: 13,473,440	N125K	probably damaging	Het
Sema5a	A	G	15: 32,460,285	D64G	probably damaging	Het
Sgo2b	T	A	8: 63,931,473	D163V	possibly damaging	Het
Slc15a1	A	T	14: 121,491,239	Y31*	probably null	Het
Smchd1	A	T	17: 71,378,257	M1392K	probably benign	Het
Sobp	T	A	10: 43,160,831	N37I	probably damaging	Het
Spock3	G	T	8: 63,220,705	C142F	probably damaging	Het
Stx6	A	C	1: 155,177,904	S86R	probably benign	Het
Sult2a4	C	A	7: 13,909,801	M280I	probably benign	Het
Synm	A	T	7: 67,736,332	D527E	probably damaging	Het
Tax1bp1	C	T	6: 52,733,320	R195W	probably damaging	Het
Themis2	A	T	4: 132,792,485	N76K	possibly damaging	Het
Tmem8b	A	G	4: 43,690,234	T890A	probably benign	Het
Traf7	T	A	17: 24,511,811	H366L	possibly damaging	Het
Trim30c	A	T	7: 104,383,252	V289D	probably benign	Het
Tsr1	T	A	11: 74,902,088	D407E	probably damaging	Het
Ubap2	G	T	4: 41,235,593	A33E	probably damaging	Het
Unc13d	C	A	11: 116,073,875	R255L	possibly damaging	Het
Ush2a	G	T	1: 188,810,337	G3367*	probably null	Het
Vmn1r229	T	C	17: 20,814,529	L12P	probably damaging	Het
Vmn2r27	C	A	6: 124,200,515	G510V	probably damaging	Het
Vps4b	T	C	1: 106,779,982	E257G	probably damaging	Het
Vps72	T	C	3: 95,119,151	S136P	probably damaging	Het
Wdr36	T	C	18: 32,843,885	I181T	possibly damaging	Het
Wdr63	T	C	3: 146,097,241	D65G	probably benign	Het
Wfikkn1	C	T	17: 25,877,791	A520T	probably benign	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TCAGAGAACAACGATCTGGCAGAAAC -3'
(R):5'- GCCTGTGCTTTCGGCCACT -3'

Sequencing Primer
(F):5'- agagatggctcagtggttaag -3'
(R):5'- ATGTGTCTGTACCTGCTACATAG -3'

Posted On

2014-03-28