Incidental Mutation 'R1484:Unc13d'
ID163338
Institutional Source Beutler Lab
Gene Symbol Unc13d
Ensembl Gene ENSMUSG00000057948
Gene Nameunc-13 homolog D (C. elegans)
Synonyms2610108D09Rik, Munc13-4, Jinx
MMRRC Submission 039537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116062095-116077961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116073875 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 255 (R255L)
Ref Sequence ENSEMBL: ENSMUSP00000133679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074628] [ENSMUST00000075036] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000153408] [ENSMUST00000156545] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect probably benign
Transcript: ENSMUST00000074628
SMART Domains Protein: ENSMUSP00000074204
Gene: ENSMUSG00000034341

DomainStartEndE-ValueType
Pfam:GRAM 1 84 1.2e-19 PFAM
Pfam:WWbp 100 204 1.3e-20 PFAM
low complexity region 247 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075036
AA Change: R255L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948
AA Change: R255L

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106450
AA Change: R255L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948
AA Change: R255L

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106451
AA Change: R255L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948
AA Change: R255L

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153408
SMART Domains Protein: ENSMUSP00000115327
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155120
Predicted Effect probably benign
Transcript: ENSMUST00000156545
SMART Domains Protein: ENSMUSP00000118266
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173345
AA Change: R255L

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948
AA Change: R255L

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173943
Predicted Effect probably benign
Transcript: ENSMUST00000174822
AA Change: R255L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948
AA Change: R255L

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Meta Mutation Damage Score 0.1095 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the UNC13 family, containing similar domain structure as other family members but lacking an N-terminal phorbol ester-binding C1 domain present in other Munc13 proteins. The protein appears to play a role in vesicle maturation during exocytosis and is involved in regulation of cytolytic granules secretion. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis type 3, a genetically heterogeneous, rare autosomal recessive disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted deletion of this gene leads to defective hemostasis, abrogated thrombus formation and protection of homozygotes from ischemic stroke in the absence of intracranial bleeding. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Ano5 T A 7: 51,566,320 D348E probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
C2cd3 C T 7: 100,440,190 R1638W probably damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Esrra T C 19: 6,912,829 Y209C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nbeal1 T C 1: 60,200,939 F155L probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nfya A T 17: 48,393,542 probably benign Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Pigo G C 4: 43,024,779 P107A probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema3a T G 5: 13,473,440 N125K probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wdr63 T C 3: 146,097,241 D65G probably benign Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in Unc13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Unc13d APN 11 116074403 missense probably damaging 0.99
IGL00976:Unc13d APN 11 116070467 missense probably damaging 1.00
IGL01630:Unc13d APN 11 116073866 missense probably benign 0.00
IGL01761:Unc13d APN 11 116073869 missense probably damaging 1.00
IGL01772:Unc13d APN 11 116076532 missense possibly damaging 0.91
IGL01935:Unc13d APN 11 116069751 missense probably benign
IGL02486:Unc13d APN 11 116069806 splice site probably benign
IGL02503:Unc13d APN 11 116068802 missense possibly damaging 0.82
IGL02519:Unc13d APN 11 116070533 missense probably damaging 1.00
IGL02524:Unc13d APN 11 116070319 missense probably damaging 1.00
IGL02634:Unc13d APN 11 116070556 splice site probably benign
IGL02636:Unc13d APN 11 116073618 missense probably damaging 1.00
IGL03243:Unc13d APN 11 116067844 missense probably benign 0.34
jinx UTSW 11 116073423 unclassified probably benign
R0033:Unc13d UTSW 11 116069165 missense probably benign 0.00
R0084:Unc13d UTSW 11 116063831 missense probably damaging 1.00
R0122:Unc13d UTSW 11 116065482 missense probably benign 0.00
R0422:Unc13d UTSW 11 116070020 critical splice donor site probably null
R0666:Unc13d UTSW 11 116069492 splice site probably benign
R1019:Unc13d UTSW 11 116068074 missense probably benign 0.03
R1333:Unc13d UTSW 11 116073555 splice site probably benign
R1594:Unc13d UTSW 11 116068712 missense probably benign 0.04
R1597:Unc13d UTSW 11 116074436 missense probably benign 0.02
R1603:Unc13d UTSW 11 116073655 missense possibly damaging 0.86
R1662:Unc13d UTSW 11 116068673 missense probably null 1.00
R1909:Unc13d UTSW 11 116070295 missense probably damaging 0.99
R2015:Unc13d UTSW 11 116068755 missense probably damaging 1.00
R2313:Unc13d UTSW 11 116063734 missense probably damaging 1.00
R2435:Unc13d UTSW 11 116068688 missense probably damaging 1.00
R4705:Unc13d UTSW 11 116073388 missense possibly damaging 0.70
R4732:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4733:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4792:Unc13d UTSW 11 116070282 missense probably damaging 1.00
R4843:Unc13d UTSW 11 116074259 missense probably damaging 1.00
R5496:Unc13d UTSW 11 116066708 missense probably damaging 1.00
R5571:Unc13d UTSW 11 116063654 missense probably benign 0.00
R5589:Unc13d UTSW 11 116069753 missense probably damaging 0.99
R5838:Unc13d UTSW 11 116064625 missense possibly damaging 0.80
R6058:Unc13d UTSW 11 116073568 critical splice donor site probably null
R6266:Unc13d UTSW 11 116068238 missense probably damaging 1.00
R6807:Unc13d UTSW 11 116066751 missense probably damaging 0.98
R7085:Unc13d UTSW 11 116064807 missense probably benign 0.07
R7098:Unc13d UTSW 11 116063726 missense probably damaging 1.00
R7269:Unc13d UTSW 11 116068230 missense probably benign 0.01
R7291:Unc13d UTSW 11 116074050 missense possibly damaging 0.79
R7453:Unc13d UTSW 11 116067871 missense probably benign
R7486:Unc13d UTSW 11 116074433 missense possibly damaging 0.68
R7618:Unc13d UTSW 11 116066721 missense probably damaging 1.00
R7817:Unc13d UTSW 11 116076283 missense probably damaging 1.00
R7952:Unc13d UTSW 11 116064941 intron probably null
X0027:Unc13d UTSW 11 116069756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCAGGTATAGCCAGTTCTCCC -3'
(R):5'- ACTGTGGAGTCTGTCAGGCAGAAG -3'

Sequencing Primer
(F):5'- GTATAGCCAGTTCTCCCCAACC -3'
(R):5'- TAAAGGCCAGGACGACTTTC -3'
Posted On2014-03-28