Incidental Mutation 'R1484:Esrra'
ID163361
Institutional Source Beutler Lab
Gene Symbol Esrra
Ensembl Gene ENSMUSG00000024955
Gene Nameestrogen related receptor, alpha
SynonymsERRalpha, Err1, Estrra, Nr3b1
MMRRC Submission 039537-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1484 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6910977-6921813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6912829 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 209 (Y209C)
Ref Sequence ENSEMBL: ENSMUSP00000025906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025904] [ENSMUST00000025906] [ENSMUST00000088257] [ENSMUST00000116551] [ENSMUST00000149261] [ENSMUST00000173091] [ENSMUST00000173635] [ENSMUST00000174786]
Predicted Effect probably benign
Transcript: ENSMUST00000025904
SMART Domains Protein: ENSMUSP00000025904
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 53 206 1e-31 PFAM
Pfam:AhpC-TSA 54 189 8.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025906
AA Change: Y209C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025906
Gene: ENSMUSG00000024955
AA Change: Y209C

DomainStartEndE-ValueType
internal_repeat_1 5 21 6.74e-5 PROSPERO
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 76 147 2.16e-40 SMART
low complexity region 169 187 N/A INTRINSIC
internal_repeat_1 202 218 6.74e-5 PROSPERO
HOLI 229 391 9.21e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088257
SMART Domains Protein: ENSMUSP00000085591
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116551
SMART Domains Protein: ENSMUSP00000112250
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145300
Predicted Effect probably benign
Transcript: ENSMUST00000149261
SMART Domains Protein: ENSMUSP00000135084
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 56 210 1.1e-31 PFAM
Pfam:AhpC-TSA 57 192 6.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172869
Predicted Effect probably benign
Transcript: ENSMUST00000173091
SMART Domains Protein: ENSMUSP00000134521
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 53 99 3.3e-11 PFAM
Pfam:AhpC-TSA 54 100 9.3e-8 PFAM
Pfam:Redoxin 97 163 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173308
Predicted Effect probably benign
Transcript: ENSMUST00000173635
AA Change: Y66C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134587
Gene: ENSMUSG00000024955
AA Change: Y66C

DomainStartEndE-ValueType
PDB:1LO1|A 1 21 6e-7 PDB
low complexity region 26 44 N/A INTRINSIC
Pfam:Hormone_recep 65 158 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174786
SMART Domains Protein: ENSMUSP00000134000
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 101 5.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183724
Meta Mutation Damage Score 0.1239 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (85/88)
MGI Phenotype PHENOTYPE: Homozygous mice for one mutation were viable but showed reduced weight gain associated with decreased peripheral fat deposition. Mutant mice were resistant to high-fat diet induced obesity. Another targeted mutation resulted in no significant abnormalities in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A T 5: 26,479,778 noncoding transcript Het
Acvr1 A T 2: 58,479,889 V36E probably damaging Het
Aldh4a1 A G 4: 139,643,447 I414V probably benign Het
Alox5 C T 6: 116,454,167 C100Y probably damaging Het
Ano5 T A 7: 51,566,320 D348E probably damaging Het
Arhgap30 G A 1: 171,403,271 V199M probably damaging Het
Arl13b T A 16: 62,806,636 Q234L probably benign Het
Atxn1 C A 13: 45,557,576 E627* probably null Het
Bend3 T C 10: 43,510,201 F197L probably benign Het
Brca1 A T 11: 101,529,812 V190E possibly damaging Het
Brpf1 T C 6: 113,315,135 W381R probably damaging Het
Brwd1 A C 16: 96,028,291 probably null Het
C1s2 T C 6: 124,625,645 I530V possibly damaging Het
C2cd3 C T 7: 100,440,190 R1638W probably damaging Het
Capns1 T A 7: 30,194,086 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep126 G A 9: 8,100,553 T660I possibly damaging Het
Cep295 A C 9: 15,334,784 I744R probably damaging Het
Chd3 T C 11: 69,359,899 E668G probably benign Het
Chek2 A G 5: 110,848,687 T172A probably damaging Het
Col6a4 A G 9: 106,013,302 probably null Het
Coq3 G A 4: 21,900,291 V173I probably benign Het
Cyp4x1 A T 4: 115,112,901 I343N probably damaging Het
D430042O09Rik C A 7: 125,816,571 probably benign Het
Dnah7b T A 1: 46,137,543 D774E probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Gpr149 A T 3: 62,595,171 D421E probably benign Het
Gpr15 T C 16: 58,718,574 N51D probably damaging Het
Gpr156 T C 16: 37,992,196 V298A probably damaging Het
Hmcn2 G A 2: 31,346,495 G350D probably damaging Het
Ifih1 A T 2: 62,610,558 N421K probably benign Het
Ilvbl C A 10: 78,576,730 T95K probably damaging Het
Itgb4 T A 11: 115,999,799 D1104E probably benign Het
Lipf A T 19: 33,964,780 M37L probably benign Het
Lyst T A 13: 13,678,190 N2258K probably benign Het
Moxd1 A G 10: 24,223,860 Y86C probably damaging Het
Muc5ac T C 7: 141,813,892 probably null Het
Myo16 G A 8: 10,560,145 R1162H probably damaging Het
Myo5c A T 9: 75,300,810 N1609Y probably damaging Het
Nbeal1 T C 1: 60,200,939 F155L probably damaging Het
Nek4 A T 14: 30,982,333 M602L possibly damaging Het
Nek9 A G 12: 85,301,848 S971P probably damaging Het
Nfya A T 17: 48,393,542 probably benign Het
Nrxn3 A T 12: 89,254,777 N442I probably damaging Het
Nupl2 A C 5: 24,178,077 K200N probably benign Het
Olfr1216 G A 2: 89,013,369 R232* probably null Het
Olfr385 T A 11: 73,589,361 I126L possibly damaging Het
Olfr850 G A 9: 19,478,127 T38I probably damaging Het
Pcdh15 T A 10: 74,291,001 I304N probably damaging Het
Pigo G C 4: 43,024,779 P107A probably damaging Het
Plce1 C T 19: 38,705,339 Q769* probably null Het
Plin2 C T 4: 86,657,244 R356H probably benign Het
Ppp1r9a G T 6: 5,113,712 E739* probably null Het
Ppp3cc G T 14: 70,240,948 N268K probably damaging Het
Prkag3 T A 1: 74,740,760 D472V probably damaging Het
Ptch2 A T 4: 117,110,849 D846V probably damaging Het
Rhob A T 12: 8,499,388 M82K probably damaging Het
Rps6kc1 T A 1: 190,799,475 R777W possibly damaging Het
Sap130 T A 18: 31,711,327 V850E probably damaging Het
Sema3a T G 5: 13,473,440 N125K probably damaging Het
Sema5a A G 15: 32,460,285 D64G probably damaging Het
Sgo2b T A 8: 63,931,473 D163V possibly damaging Het
Slc15a1 A T 14: 121,491,239 Y31* probably null Het
Smchd1 A T 17: 71,378,257 M1392K probably benign Het
Sobp T A 10: 43,160,831 N37I probably damaging Het
Spock3 G T 8: 63,220,705 C142F probably damaging Het
Stx6 A C 1: 155,177,904 S86R probably benign Het
Sult2a4 C A 7: 13,909,801 M280I probably benign Het
Synm A T 7: 67,736,332 D527E probably damaging Het
Tax1bp1 C T 6: 52,733,320 R195W probably damaging Het
Themis2 A T 4: 132,792,485 N76K possibly damaging Het
Tmem8b A G 4: 43,690,234 T890A probably benign Het
Traf7 T A 17: 24,511,811 H366L possibly damaging Het
Trim30c A T 7: 104,383,252 V289D probably benign Het
Tsr1 T A 11: 74,902,088 D407E probably damaging Het
Ubap2 G T 4: 41,235,593 A33E probably damaging Het
Unc13d C A 11: 116,073,875 R255L possibly damaging Het
Ush2a G T 1: 188,810,337 G3367* probably null Het
Vmn1r229 T C 17: 20,814,529 L12P probably damaging Het
Vmn2r27 C A 6: 124,200,515 G510V probably damaging Het
Vps4b T C 1: 106,779,982 E257G probably damaging Het
Vps72 T C 3: 95,119,151 S136P probably damaging Het
Wdr36 T C 18: 32,843,885 I181T possibly damaging Het
Wdr63 T C 3: 146,097,241 D65G probably benign Het
Wfikkn1 C T 17: 25,877,791 A520T probably benign Het
Other mutations in Esrra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Esrra APN 19 6912732 missense probably damaging 1.00
IGL02153:Esrra APN 19 6913822 missense probably benign 0.38
IGL02396:Esrra APN 19 6912005 missense probably benign
IGL02642:Esrra APN 19 6912850 missense possibly damaging 0.85
R1463:Esrra UTSW 19 6912455 missense probably benign
R1546:Esrra UTSW 19 6920297 missense probably benign 0.07
R1848:Esrra UTSW 19 6912010 missense probably benign 0.05
R2397:Esrra UTSW 19 6920176 missense probably damaging 1.00
R4853:Esrra UTSW 19 6920072 missense probably damaging 1.00
R5580:Esrra UTSW 19 6920387 start codon destroyed probably null 0.01
R5587:Esrra UTSW 19 6920207 missense probably benign
R6270:Esrra UTSW 19 6914120 unclassified probably null
R6612:Esrra UTSW 19 6911852 missense probably benign 0.01
R6807:Esrra UTSW 19 6911774 missense probably benign 0.14
R7288:Esrra UTSW 19 6912771 nonsense probably null
R7599:Esrra UTSW 19 6913846 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTGTTCAAGGATGCTCAACCACC -3'
(R):5'- AGACTGTGGCGTCTGTAAGCTACC -3'

Sequencing Primer
(F):5'- CCAGCCCTTTACCTGGGATG -3'
(R):5'- GCCCTTCTCTGAGGAAGTGAATAC -3'
Posted On2014-03-28