Mutagenetix > Incidental Mutation

Incidental Mutation 'R1486:Atf6'

163443

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

039539-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R1486 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 170794691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 454 (C454R)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027974
AA Change: C454R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: C454R

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182787

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,737,418	L633P	probably damaging	Het
4930430A15Rik	T	G	2: 111,200,358	Q402P	possibly damaging	Het
4933425L06Rik	T	C	13: 105,109,783	V284A	probably benign	Het
A730015C16Rik	A	G	4: 108,847,946	E19G	probably benign	Het
A730018C14Rik	T	C	12: 112,415,695		noncoding transcript	Het
Acrbp	T	A	6: 125,050,622	Y78N	probably damaging	Het
Adamtsl4	T	C	3: 95,681,856	S422G	probably benign	Het
Apba2	T	C	7: 64,736,948	V429A	probably damaging	Het
Bhlhe40	T	C	6: 108,664,929	I278T	probably damaging	Het
Birc6	G	T	17: 74,639,820	V2845L	probably damaging	Het
Card11	T	C	5: 140,876,519	I1008V	probably benign	Het
Catsperg1	C	A	7: 29,185,495	K900N	probably damaging	Het
Chek2	T	G	5: 110,841,227		probably benign	Het
Dnah9	A	T	11: 65,834,272	S4352T	probably damaging	Het
Eif3c	C	T	7: 126,564,721	R50Q	probably damaging	Het
Eml6	A	C	11: 29,805,114	I887S	possibly damaging	Het
Fopnl	A	G	16: 14,300,140	V172A	probably benign	Het
Gipc1	C	T	8: 83,661,179	Q63*	probably null	Het
Grm4	A	G	17: 27,434,717	L706P	probably damaging	Het
Irak3	T	C	10: 120,143,061	D495G	probably damaging	Het
Itga9	T	G	9: 118,626,450	V64G	probably damaging	Het
Iws1	T	C	18: 32,097,256	I759T	probably damaging	Het
Kdm3b	T	A	18: 34,834,304	F1721I	probably damaging	Het
Lrrc8c	T	A	5: 105,607,529	V390E	probably damaging	Het
Mki67	G	A	7: 135,699,720	T1195I	probably benign	Het
Mphosph8	C	T	14: 56,689,039	T646I	probably damaging	Het
Ncdn	A	T	4: 126,748,598	V422D	probably damaging	Het
Nrg1	T	C	8: 31,818,344	E548G	probably damaging	Het
Nup37	T	C	10: 88,148,254	Y11H	probably damaging	Het
Olfr1062	T	A	2: 86,423,481	H65L	probably damaging	Het
Olfr1377	G	A	11: 50,984,781	V27I	probably benign	Het
Olfr585	A	T	7: 103,098,430	I230F	probably damaging	Het
Olfr601	T	A	7: 103,358,994	M67L	possibly damaging	Het
Pcgf1	T	G	6: 83,079,126	S70R	probably damaging	Het
Prps1l3	C	T	12: 57,238,787	A121V	probably benign	Het
Rasal1	T	C	5: 120,654,852	Y57H	probably damaging	Het
Rbm12b2	A	G	4: 12,094,841	R567G	probably benign	Het
Rep15	T	A	6: 147,033,079	F139I	probably damaging	Het
Ros1	T	C	10: 52,172,858	Y92C	probably damaging	Het
Sin3b	A	G	8: 72,750,513	T803A	probably benign	Het
Skint11	G	A	4: 114,194,818		probably null	Het
Sobp	T	G	10: 43,022,522	S356R	probably benign	Het
Spats2l	T	C	1: 57,900,811	I228T	probably damaging	Het
Sqor	G	A	2: 122,807,645		probably null	Het
Stox1	T	C	10: 62,664,636	D715G	probably benign	Het
Tln2	C	A	9: 67,311,839	G275W	probably damaging	Het
Tmc5	C	T	7: 118,673,432	P942S	probably benign	Het
Tor4a	A	T	2: 25,194,679	I404N	possibly damaging	Het
Ttc3	G	A	16: 94,448,129	R1162Q	probably damaging	Het
Zfp451	T	C	1: 33,777,727	K164E	probably damaging	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGCAAGTCAGATTCTCTTGGCCTC -3'
(R):5'- CAGCAGGTGCTGCCCAGTAAATAG -3'

Sequencing Primer
(F):5'- CTTGGCCTCTTACTAAAGCTGAAG -3'
(R):5'- CAAATGTGAATTACTCTGCCAGCTC -3'

Posted On

2014-03-28