Incidental Mutation 'R1486:Card11'
ID163459
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Namecaspase recruitment domain family, member 11
SynonymsCARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
MMRRC Submission 039539-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1486 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location140872990-141000582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140876519 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1008 (I1008V)
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
Predicted Effect probably benign
Transcript: ENSMUST00000085786
AA Change: I1008V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: I1008V

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196169
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,737,418 L633P probably damaging Het
4930430A15Rik T G 2: 111,200,358 Q402P possibly damaging Het
4933425L06Rik T C 13: 105,109,783 V284A probably benign Het
A730015C16Rik A G 4: 108,847,946 E19G probably benign Het
A730018C14Rik T C 12: 112,415,695 noncoding transcript Het
Acrbp T A 6: 125,050,622 Y78N probably damaging Het
Adamtsl4 T C 3: 95,681,856 S422G probably benign Het
Apba2 T C 7: 64,736,948 V429A probably damaging Het
Atf6 A G 1: 170,794,691 C454R probably damaging Het
Bhlhe40 T C 6: 108,664,929 I278T probably damaging Het
Birc6 G T 17: 74,639,820 V2845L probably damaging Het
Catsperg1 C A 7: 29,185,495 K900N probably damaging Het
Chek2 T G 5: 110,841,227 probably benign Het
Dnah9 A T 11: 65,834,272 S4352T probably damaging Het
Eif3c C T 7: 126,564,721 R50Q probably damaging Het
Eml6 A C 11: 29,805,114 I887S possibly damaging Het
Fopnl A G 16: 14,300,140 V172A probably benign Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Grm4 A G 17: 27,434,717 L706P probably damaging Het
Irak3 T C 10: 120,143,061 D495G probably damaging Het
Itga9 T G 9: 118,626,450 V64G probably damaging Het
Iws1 T C 18: 32,097,256 I759T probably damaging Het
Kdm3b T A 18: 34,834,304 F1721I probably damaging Het
Lrrc8c T A 5: 105,607,529 V390E probably damaging Het
Mki67 G A 7: 135,699,720 T1195I probably benign Het
Mphosph8 C T 14: 56,689,039 T646I probably damaging Het
Ncdn A T 4: 126,748,598 V422D probably damaging Het
Nrg1 T C 8: 31,818,344 E548G probably damaging Het
Nup37 T C 10: 88,148,254 Y11H probably damaging Het
Olfr1062 T A 2: 86,423,481 H65L probably damaging Het
Olfr1377 G A 11: 50,984,781 V27I probably benign Het
Olfr585 A T 7: 103,098,430 I230F probably damaging Het
Olfr601 T A 7: 103,358,994 M67L possibly damaging Het
Pcgf1 T G 6: 83,079,126 S70R probably damaging Het
Prps1l3 C T 12: 57,238,787 A121V probably benign Het
Rasal1 T C 5: 120,654,852 Y57H probably damaging Het
Rbm12b2 A G 4: 12,094,841 R567G probably benign Het
Rep15 T A 6: 147,033,079 F139I probably damaging Het
Ros1 T C 10: 52,172,858 Y92C probably damaging Het
Sin3b A G 8: 72,750,513 T803A probably benign Het
Skint11 G A 4: 114,194,818 probably null Het
Sobp T G 10: 43,022,522 S356R probably benign Het
Spats2l T C 1: 57,900,811 I228T probably damaging Het
Sqor G A 2: 122,807,645 probably null Het
Stox1 T C 10: 62,664,636 D715G probably benign Het
Tln2 C A 9: 67,311,839 G275W probably damaging Het
Tmc5 C T 7: 118,673,432 P942S probably benign Het
Tor4a A T 2: 25,194,679 I404N possibly damaging Het
Ttc3 G A 16: 94,448,129 R1162Q probably damaging Het
Zfp451 T C 1: 33,777,727 K164E probably damaging Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 intron probably benign
IGL00961:Card11 APN 5 140899709 missense probably damaging 0.97
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140927726 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140883546 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140878126 missense probably benign 0.10
IGL03255:Card11 APN 5 140898331 missense possibly damaging 0.73
Caravaggio UTSW 5 140913309 missense probably damaging 1.00
Dealer UTSW 5 140885877 missense probably damaging 1.00
hubei UTSW 5 140906767 missense probably damaging 0.96
king UTSW 5 140891080 splice site probably benign
may UTSW 5 140876495 nonsense probably null
Poker UTSW 5 140878082 missense probably benign
Sharp UTSW 5 140876425 missense possibly damaging 0.93
Tumnus UTSW 5 140885945 missense possibly damaging 0.75
unmodulated2 UTSW 5 140883782 splice site probably null
PIT4243001:Card11 UTSW 5 140908604 missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140876408 missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140906660 missense probably damaging 0.99
R0046:Card11 UTSW 5 140908524 missense possibly damaging 0.92
R0285:Card11 UTSW 5 140887101 missense probably damaging 1.00
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2027:Card11 UTSW 5 140906767 missense probably damaging 0.96
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140889133 missense probably benign 0.09
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4778:Card11 UTSW 5 140883782 splice site probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
R6184:Card11 UTSW 5 140898278 missense probably damaging 1.00
R6792:Card11 UTSW 5 140913309 missense probably damaging 1.00
R6825:Card11 UTSW 5 140878082 missense probably benign
R7008:Card11 UTSW 5 140873393 missense probably damaging 1.00
R7291:Card11 UTSW 5 140901070 missense probably damaging 1.00
R7376:Card11 UTSW 5 140898238 missense probably benign 0.01
R7526:Card11 UTSW 5 140913429 intron probably null
R7683:Card11 UTSW 5 140896026 missense probably benign
R7730:Card11 UTSW 5 140885996 missense probably damaging 0.96
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- ATGACCCAGTGCCTCACAGAGATG -3'
(R):5'- CAGAGTCCAAGTGTTTACGGAGCC -3'

Sequencing Primer
(F):5'- GCCTCACAGAGATGGTTGG -3'
(R):5'- CATGGTCTGGCAGAGCAATC -3'
Posted On2014-03-28