Incidental Mutation 'R1486:Bhlhe40'
ID 163462
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 039539-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1486 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108641890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 278 (I278T)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably damaging
Transcript: ENSMUST00000032194
AA Change: I278T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: I278T

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730015C16Rik A G 4: 108,705,143 (GRCm39) E19G probably benign Het
A730018C14Rik T C 12: 112,382,129 (GRCm39) noncoding transcript Het
Acrbp T A 6: 125,027,585 (GRCm39) Y78N probably damaging Het
Adamtsl4 T C 3: 95,589,166 (GRCm39) S422G probably benign Het
Apba2 T C 7: 64,386,696 (GRCm39) V429A probably damaging Het
Atf6 A G 1: 170,622,260 (GRCm39) C454R probably damaging Het
Birc6 G T 17: 74,946,815 (GRCm39) V2845L probably damaging Het
Card11 T C 5: 140,862,274 (GRCm39) I1008V probably benign Het
Catsperg1 C A 7: 28,884,920 (GRCm39) K900N probably damaging Het
Cep20 A G 16: 14,118,004 (GRCm39) V172A probably benign Het
Chek2 T G 5: 110,989,093 (GRCm39) probably benign Het
Dnaaf9 A G 2: 130,579,338 (GRCm39) L633P probably damaging Het
Dnah9 A T 11: 65,725,098 (GRCm39) S4352T probably damaging Het
Eif3c C T 7: 126,163,893 (GRCm39) R50Q probably damaging Het
Eml6 A C 11: 29,755,114 (GRCm39) I887S possibly damaging Het
Gipc1 C T 8: 84,387,808 (GRCm39) Q63* probably null Het
Grm4 A G 17: 27,653,691 (GRCm39) L706P probably damaging Het
Irak3 T C 10: 119,978,966 (GRCm39) D495G probably damaging Het
Itga9 T G 9: 118,455,518 (GRCm39) V64G probably damaging Het
Iws1 T C 18: 32,230,309 (GRCm39) I759T probably damaging Het
Kdm3b T A 18: 34,967,357 (GRCm39) F1721I probably damaging Het
Lrrc8c T A 5: 105,755,395 (GRCm39) V390E probably damaging Het
Mki67 G A 7: 135,301,449 (GRCm39) T1195I probably benign Het
Mphosph8 C T 14: 56,926,496 (GRCm39) T646I probably damaging Het
Ncdn A T 4: 126,642,391 (GRCm39) V422D probably damaging Het
Nrg1 T C 8: 32,308,372 (GRCm39) E548G probably damaging Het
Nt5el T C 13: 105,246,291 (GRCm39) V284A probably benign Het
Nup37 T C 10: 87,984,116 (GRCm39) Y11H probably damaging Het
Or1ad1 G A 11: 50,875,608 (GRCm39) V27I probably benign Het
Or51f1e A T 7: 102,747,637 (GRCm39) I230F probably damaging Het
Or52s19 T A 7: 103,008,201 (GRCm39) M67L possibly damaging Het
Or8j3c T A 2: 86,253,825 (GRCm39) H65L probably damaging Het
Pcgf1 T G 6: 83,056,107 (GRCm39) S70R probably damaging Het
Potefam1 T G 2: 111,030,703 (GRCm39) Q402P possibly damaging Het
Prps1l3 C T 12: 57,285,573 (GRCm39) A121V probably benign Het
Rasal1 T C 5: 120,792,917 (GRCm39) Y57H probably damaging Het
Rbm12b2 A G 4: 12,094,841 (GRCm39) R567G probably benign Het
Rep15 T A 6: 146,934,577 (GRCm39) F139I probably damaging Het
Ros1 T C 10: 52,048,954 (GRCm39) Y92C probably damaging Het
Sin3b A G 8: 73,477,141 (GRCm39) T803A probably benign Het
Skint11 G A 4: 114,052,015 (GRCm39) probably null Het
Sobp T G 10: 42,898,518 (GRCm39) S356R probably benign Het
Spats2l T C 1: 57,939,970 (GRCm39) I228T probably damaging Het
Sqor G A 2: 122,649,565 (GRCm39) probably null Het
Stox1 T C 10: 62,500,415 (GRCm39) D715G probably benign Het
Tln2 C A 9: 67,219,121 (GRCm39) G275W probably damaging Het
Tmc5 C T 7: 118,272,655 (GRCm39) P942S probably benign Het
Tor4a A T 2: 25,084,691 (GRCm39) I404N possibly damaging Het
Ttc3 G A 16: 94,248,988 (GRCm39) R1162Q probably damaging Het
Zfp451 T C 1: 33,816,808 (GRCm39) K164E probably damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AACCATTGGACTCGGCTCCCAAAG -3'
(R):5'- GCATTTCTCCAGCATAGGCAGGTAG -3'

Sequencing Primer
(F):5'- AACTGTGTGCCAGTCATCCAG -3'
(R):5'- GTAGGCAGTGGCCGATG -3'
Posted On 2014-03-28