Incidental Mutation 'R1486:Mphosph8'
ID163494
Institutional Source Beutler Lab
Gene Symbol Mphosph8
Ensembl Gene ENSMUSG00000079184
Gene NameM-phase phosphoprotein 8
Synonyms4930548G07Rik, 1500035L22Rik
MMRRC Submission 039539-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R1486 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location56668248-56697430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56689039 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 646 (T646I)
Ref Sequence ENSEMBL: ENSMUSP00000112170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116468]
Predicted Effect probably damaging
Transcript: ENSMUST00000116468
AA Change: T646I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112170
Gene: ENSMUSG00000079184
AA Change: T646I

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
CHROMO 58 111 6.2e-13 SMART
low complexity region 152 160 N/A INTRINSIC
coiled coil region 226 256 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
Blast:ANK 563 592 1e-7 BLAST
ANK 598 627 4.43e-2 SMART
ANK 631 660 5.45e-2 SMART
ANK 664 693 1.08e-5 SMART
Blast:ANK 697 726 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152606
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,737,418 L633P probably damaging Het
4930430A15Rik T G 2: 111,200,358 Q402P possibly damaging Het
4933425L06Rik T C 13: 105,109,783 V284A probably benign Het
A730015C16Rik A G 4: 108,847,946 E19G probably benign Het
A730018C14Rik T C 12: 112,415,695 noncoding transcript Het
Acrbp T A 6: 125,050,622 Y78N probably damaging Het
Adamtsl4 T C 3: 95,681,856 S422G probably benign Het
Apba2 T C 7: 64,736,948 V429A probably damaging Het
Atf6 A G 1: 170,794,691 C454R probably damaging Het
Bhlhe40 T C 6: 108,664,929 I278T probably damaging Het
Birc6 G T 17: 74,639,820 V2845L probably damaging Het
Card11 T C 5: 140,876,519 I1008V probably benign Het
Catsperg1 C A 7: 29,185,495 K900N probably damaging Het
Chek2 T G 5: 110,841,227 probably benign Het
Dnah9 A T 11: 65,834,272 S4352T probably damaging Het
Eif3c C T 7: 126,564,721 R50Q probably damaging Het
Eml6 A C 11: 29,805,114 I887S possibly damaging Het
Fopnl A G 16: 14,300,140 V172A probably benign Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Grm4 A G 17: 27,434,717 L706P probably damaging Het
Irak3 T C 10: 120,143,061 D495G probably damaging Het
Itga9 T G 9: 118,626,450 V64G probably damaging Het
Iws1 T C 18: 32,097,256 I759T probably damaging Het
Kdm3b T A 18: 34,834,304 F1721I probably damaging Het
Lrrc8c T A 5: 105,607,529 V390E probably damaging Het
Mki67 G A 7: 135,699,720 T1195I probably benign Het
Ncdn A T 4: 126,748,598 V422D probably damaging Het
Nrg1 T C 8: 31,818,344 E548G probably damaging Het
Nup37 T C 10: 88,148,254 Y11H probably damaging Het
Olfr1062 T A 2: 86,423,481 H65L probably damaging Het
Olfr1377 G A 11: 50,984,781 V27I probably benign Het
Olfr585 A T 7: 103,098,430 I230F probably damaging Het
Olfr601 T A 7: 103,358,994 M67L possibly damaging Het
Pcgf1 T G 6: 83,079,126 S70R probably damaging Het
Prps1l3 C T 12: 57,238,787 A121V probably benign Het
Rasal1 T C 5: 120,654,852 Y57H probably damaging Het
Rbm12b2 A G 4: 12,094,841 R567G probably benign Het
Rep15 T A 6: 147,033,079 F139I probably damaging Het
Ros1 T C 10: 52,172,858 Y92C probably damaging Het
Sin3b A G 8: 72,750,513 T803A probably benign Het
Skint11 G A 4: 114,194,818 probably null Het
Sobp T G 10: 43,022,522 S356R probably benign Het
Spats2l T C 1: 57,900,811 I228T probably damaging Het
Sqor G A 2: 122,807,645 probably null Het
Stox1 T C 10: 62,664,636 D715G probably benign Het
Tln2 C A 9: 67,311,839 G275W probably damaging Het
Tmc5 C T 7: 118,673,432 P942S probably benign Het
Tor4a A T 2: 25,194,679 I404N possibly damaging Het
Ttc3 G A 16: 94,448,129 R1162Q probably damaging Het
Zfp451 T C 1: 33,777,727 K164E probably damaging Het
Other mutations in Mphosph8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Mphosph8 APN 14 56674443 missense probably benign 0.00
IGL00786:Mphosph8 APN 14 56672544 missense probably benign 0.00
IGL01635:Mphosph8 APN 14 56672546 missense probably damaging 0.99
IGL02104:Mphosph8 APN 14 56674579 missense probably benign 0.02
IGL02387:Mphosph8 APN 14 56695721 missense probably damaging 1.00
IGL02486:Mphosph8 APN 14 56688387 missense possibly damaging 0.80
IGL02547:Mphosph8 APN 14 56672484 missense probably damaging 1.00
IGL02578:Mphosph8 APN 14 56674210 missense probably benign
IGL03247:Mphosph8 APN 14 56678820 critical splice donor site probably null
IGL03377:Mphosph8 APN 14 56693486 missense probably damaging 1.00
R0412:Mphosph8 UTSW 14 56674413 missense probably damaging 0.97
R0647:Mphosph8 UTSW 14 56674405 missense probably benign
R1079:Mphosph8 UTSW 14 56674259 missense probably damaging 1.00
R1451:Mphosph8 UTSW 14 56668421 missense possibly damaging 0.62
R1687:Mphosph8 UTSW 14 56672478 missense probably damaging 1.00
R1733:Mphosph8 UTSW 14 56693459 missense probably damaging 1.00
R1809:Mphosph8 UTSW 14 56672452 missense probably damaging 1.00
R1844:Mphosph8 UTSW 14 56697159 missense probably damaging 1.00
R2132:Mphosph8 UTSW 14 56678704 missense probably benign 0.04
R4242:Mphosph8 UTSW 14 56674314 missense probably benign 0.00
R4261:Mphosph8 UTSW 14 56674465 missense probably benign 0.00
R4563:Mphosph8 UTSW 14 56691000 missense probably benign 0.00
R4962:Mphosph8 UTSW 14 56678589 missense probably benign 0.27
R5121:Mphosph8 UTSW 14 56676546 nonsense probably null
R6082:Mphosph8 UTSW 14 56668541 missense probably damaging 1.00
R6224:Mphosph8 UTSW 14 56668353 start codon destroyed probably null
R6455:Mphosph8 UTSW 14 56688486 missense probably damaging 1.00
R7086:Mphosph8 UTSW 14 56668523 missense possibly damaging 0.94
R7236:Mphosph8 UTSW 14 56674297 missense possibly damaging 0.63
R7266:Mphosph8 UTSW 14 56685040 missense possibly damaging 0.89
R7564:Mphosph8 UTSW 14 56674038 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCACCTGCATGGAGTTGAATC -3'
(R):5'- ACTCTTGCTGGGTCCCTTAGACTG -3'

Sequencing Primer
(F):5'- CATGGAGTTGAATCTGTGAGTC -3'
(R):5'- TTAGACTGAGCATGTCCCATAC -3'
Posted On2014-03-28