Incidental Mutation 'R1487:Cfap57'
ID 163509
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1487 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118554551-118620777 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 118614781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 134 (V134F)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
AlphaFold Q9D180
Predicted Effect probably benign
Transcript: ENSMUST00000071972
AA Change: V134F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: V134F

Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
AA Change: V134F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: V134F

Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense probably benign
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense probably benign
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense probably benign
R7412:Cfap57 UTSW 4 118614931 missense probably benign
R7414:Cfap57 UTSW 4 118614931 missense probably benign
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense probably benign
R7642:Cfap57 UTSW 4 118614931 missense probably benign
R7741:Cfap57 UTSW 4 118614931 missense probably benign
R7744:Cfap57 UTSW 4 118614931 missense probably benign
R7745:Cfap57 UTSW 4 118614931 missense probably benign
R7842:Cfap57 UTSW 4 118554755 nonsense probably null
R7936:Cfap57 UTSW 4 118614931 missense probably benign
R7940:Cfap57 UTSW 4 118614931 missense probably benign
R7942:Cfap57 UTSW 4 118614931 missense probably benign
R8074:Cfap57 UTSW 4 118569625 missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118614931 missense probably benign
R8447:Cfap57 UTSW 4 118614931 missense probably benign
R8491:Cfap57 UTSW 4 118614931 missense probably benign
R8524:Cfap57 UTSW 4 118614931 missense probably benign
R8670:Cfap57 UTSW 4 118614925 missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118593006 missense probably benign 0.04
R8790:Cfap57 UTSW 4 118581914 missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118569602 missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118554851 missense probably benign 0.02
R9212:Cfap57 UTSW 4 118579452 missense possibly damaging 0.95
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118598956 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agggaaaaagacagatgacaaac -3'
Posted On 2014-03-28