Incidental Mutation 'R1487:Gucy2c'
ID163519
Institutional Source Beutler Lab
Gene Symbol Gucy2c
Ensembl Gene ENSMUSG00000042638
Gene Nameguanylate cyclase 2c
SynonymsGC-C
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1487 (G1)
Quality Score205
Status Not validated
Chromosome6
Chromosomal Location136697284-136781765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136748826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 375 (I375F)
Ref Sequence ENSEMBL: ENSMUSP00000077236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032338
AA Change: I375F

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: I375F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 113 384 3.7e-8 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 498 744 3.4e-33 PFAM
Pfam:Pkinase 499 744 1e-26 PFAM
CYCc 787 982 2.68e-107 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000078095
AA Change: I375F

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: I375F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 53 385 2.7e-41 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 475 720 6.5e-32 PFAM
Pfam:Pkinase 480 720 7.2e-25 PFAM
CYCc 763 958 2.68e-107 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Gucy2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Gucy2c APN 6 136765614 missense probably benign 0.01
IGL01081:Gucy2c APN 6 136702739 missense probably damaging 1.00
IGL01285:Gucy2c APN 6 136709741 missense probably damaging 1.00
IGL01395:Gucy2c APN 6 136698029 missense probably damaging 1.00
IGL01408:Gucy2c APN 6 136698011 missense probably benign 0.19
IGL01752:Gucy2c APN 6 136770108 missense probably benign 0.10
IGL01766:Gucy2c APN 6 136715973 missense probably benign 0.43
IGL02245:Gucy2c APN 6 136729203 missense probably benign 0.00
IGL02648:Gucy2c APN 6 136729213 nonsense probably null
IGL02794:Gucy2c APN 6 136713148 missense probably damaging 1.00
IGL03023:Gucy2c APN 6 136702796 splice site probably null
IGL03178:Gucy2c APN 6 136729239 splice site probably benign
IGL03310:Gucy2c APN 6 136751046 missense probably benign
IGL03374:Gucy2c APN 6 136765630 missense probably benign 0.00
IGL03393:Gucy2c APN 6 136719667 missense probably benign 0.04
R0031:Gucy2c UTSW 6 136697999 missense probably damaging 0.99
R0128:Gucy2c UTSW 6 136704249 missense probably damaging 1.00
R0377:Gucy2c UTSW 6 136750917 critical splice donor site probably null
R0593:Gucy2c UTSW 6 136728335 missense probably damaging 0.99
R0613:Gucy2c UTSW 6 136760723 missense probably damaging 1.00
R0723:Gucy2c UTSW 6 136727801 splice site probably null
R0828:Gucy2c UTSW 6 136709748 missense probably damaging 1.00
R0837:Gucy2c UTSW 6 136722420 missense probably damaging 0.99
R0880:Gucy2c UTSW 6 136709832 critical splice acceptor site probably null
R1350:Gucy2c UTSW 6 136743914 critical splice donor site probably null
R1680:Gucy2c UTSW 6 136722493 missense probably damaging 1.00
R1751:Gucy2c UTSW 6 136748775 splice site probably benign
R1791:Gucy2c UTSW 6 136744027 missense probably damaging 1.00
R1953:Gucy2c UTSW 6 136704293 missense probably damaging 1.00
R2135:Gucy2c UTSW 6 136723728 missense probably damaging 1.00
R2227:Gucy2c UTSW 6 136702760 missense probably damaging 1.00
R2350:Gucy2c UTSW 6 136763074 missense probably damaging 0.98
R2906:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R2907:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R3699:Gucy2c UTSW 6 136770111 missense probably damaging 1.00
R3972:Gucy2c UTSW 6 136708366 missense probably damaging 1.00
R4613:Gucy2c UTSW 6 136708321 missense probably damaging 1.00
R4732:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4733:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4776:Gucy2c UTSW 6 136722514 missense probably damaging 1.00
R5087:Gucy2c UTSW 6 136767035 missense possibly damaging 0.69
R5284:Gucy2c UTSW 6 136763043 missense possibly damaging 0.56
R5366:Gucy2c UTSW 6 136720741 missense probably damaging 0.99
R5466:Gucy2c UTSW 6 136781465 nonsense probably null
R5911:Gucy2c UTSW 6 136722442 missense probably damaging 1.00
R6160:Gucy2c UTSW 6 136740686 nonsense probably null
R6367:Gucy2c UTSW 6 136709778 missense probably damaging 1.00
R6441:Gucy2c UTSW 6 136723761 missense probably damaging 0.98
R6812:Gucy2c UTSW 6 136697995 missense probably benign
R6865:Gucy2c UTSW 6 136770129 missense probably benign 0.13
R7065:Gucy2c UTSW 6 136720766 missense probably damaging 1.00
R7078:Gucy2c UTSW 6 136697939 missense probably benign 0.19
R7096:Gucy2c UTSW 6 136728341 missense probably benign 0.11
R7138:Gucy2c UTSW 6 136728344 missense probably damaging 1.00
R7343:Gucy2c UTSW 6 136702748 missense probably damaging 1.00
R7538:Gucy2c UTSW 6 136709744 missense probably damaging 1.00
R7587:Gucy2c UTSW 6 136704290 missense probably damaging 1.00
R7666:Gucy2c UTSW 6 136697968 missense probably benign
R7675:Gucy2c UTSW 6 136716032 missense possibly damaging 0.91
R7822:Gucy2c UTSW 6 136708406 missense probably damaging 1.00
Z1088:Gucy2c UTSW 6 136743981 missense probably benign
Z1177:Gucy2c UTSW 6 136719687
Z1177:Gucy2c UTSW 6 136767196
Predicted Primers PCR Primer
(F):5'- GCTAACACGCTTAGGGAATCCTACC -3'
(R):5'- ACCGAAGCACACATTCTGCATGG -3'

Sequencing Primer
(F):5'- GCTTAGGGAATCCTACCACAAGTG -3'
(R):5'- GCCATTGATGGTCTCCAACA -3'
Posted On2014-03-28