Incidental Mutation 'R1487:Lipe'
ID163522
Institutional Source Beutler Lab
Gene Symbol Lipe
Ensembl Gene ENSMUSG00000003123
Gene Namelipase, hormone sensitive
Synonyms4933403G17Rik, HSL
Accession Numbers

Genbank: NM_010719, NM_001039507; MGI: 96790

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25379527-25398710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25384815 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 615 (A615T)
Ref Sequence ENSEMBL: ENSMUSP00000123485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003207] [ENSMUST00000054301] [ENSMUST00000149349] [ENSMUST00000205698] [ENSMUST00000205923] [ENSMUST00000206861]
Predicted Effect probably benign
Transcript: ENSMUST00000003207
AA Change: A345T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000003207
Gene: ENSMUSG00000003123
AA Change: A345T

DomainStartEndE-ValueType
Pfam:HSL_N 44 358 4.6e-148 PFAM
Pfam:DUF2424 345 504 1.1e-8 PFAM
Pfam:Abhydrolase_3 388 548 3e-36 PFAM
low complexity region 611 626 N/A INTRINSIC
Pfam:Abhydrolase_3 684 771 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054301
AA Change: A302T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000050935
Gene: ENSMUSG00000003123
AA Change: A302T

DomainStartEndE-ValueType
Pfam:HSL_N 1 315 1.4e-148 PFAM
Pfam:DUF2424 302 461 1.5e-8 PFAM
Pfam:Abhydrolase_3 345 505 5.2e-36 PFAM
low complexity region 568 583 N/A INTRINSIC
Pfam:Abhydrolase_3 641 728 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066316
Predicted Effect possibly damaging
Transcript: ENSMUST00000149349
AA Change: A615T

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123
AA Change: A615T

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205787
Predicted Effect probably benign
Transcript: ENSMUST00000205923
AA Change: A38T

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206588
Predicted Effect probably benign
Transcript: ENSMUST00000206861
AA Change: A302T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a long and a short form, generated by use of alternative translational start codons. The long form is expressed in steroidogenic tissues such as testis, where it converts cholesteryl esters to free cholesterol for steroid hormone production. The short form is expressed in adipose tissue, among others, where it hydrolyzes stored triglycerides to free fatty acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations of this locus result in abnormal lipid homeostasis and, in some lines, defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(5) Gene trapped(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Lipe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lipe APN 7 25383552 missense probably damaging 1.00
IGL00517:Lipe APN 7 25388560 unclassified probably null
IGL00817:Lipe APN 7 25388449 missense probably damaging 1.00
IGL01459:Lipe APN 7 25383542 missense probably damaging 1.00
IGL01946:Lipe APN 7 25383276 missense possibly damaging 0.90
IGL02931:Lipe APN 7 25383335 splice site probably benign
IGL02973:Lipe APN 7 25383632 missense probably damaging 0.98
IGL03091:Lipe APN 7 25380755 missense probably damaging 1.00
reservoir UTSW 7 25380143 missense probably damaging 1.00
3-1:Lipe UTSW 7 25397820 missense probably damaging 0.97
PIT4243001:Lipe UTSW 7 25395546 missense probably benign
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0432:Lipe UTSW 7 25398488 missense probably benign 0.00
R0528:Lipe UTSW 7 25398476 missense possibly damaging 0.92
R0534:Lipe UTSW 7 25388186 missense possibly damaging 0.66
R1502:Lipe UTSW 7 25398147 missense possibly damaging 0.66
R1606:Lipe UTSW 7 25388144 missense probably damaging 1.00
R1713:Lipe UTSW 7 25385325 missense probably damaging 0.99
R2147:Lipe UTSW 7 25388521 missense probably benign 0.01
R3031:Lipe UTSW 7 25384895 missense possibly damaging 0.65
R3110:Lipe UTSW 7 25398423 missense probably benign
R3112:Lipe UTSW 7 25398423 missense probably benign
R3792:Lipe UTSW 7 25397620 missense possibly damaging 0.82
R4453:Lipe UTSW 7 25397690 missense probably damaging 0.99
R4582:Lipe UTSW 7 25397702 missense probably benign
R4816:Lipe UTSW 7 25380143 missense probably damaging 1.00
R5639:Lipe UTSW 7 25383325 missense probably benign 0.00
R5653:Lipe UTSW 7 25398408 missense probably benign 0.08
R6322:Lipe UTSW 7 25380536 missense probably damaging 1.00
R6575:Lipe UTSW 7 25383324 missense probably benign 0.03
R7065:Lipe UTSW 7 25385178 critical splice donor site probably null
R7250:Lipe UTSW 7 25388660 start gained probably benign
R7485:Lipe UTSW 7 25380611 missense probably benign 0.01
R7636:Lipe UTSW 7 25388617 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGATTTTGCCAGGCTGTTGAGTACC -3'
(R):5'- GGGGCTGAATTTGAACGCATCATAC -3'

Sequencing Primer
(F):5'- GAGTACCTTGCTGTCCTGG -3'
(R):5'- TCATACAGAACCTGGATGTGC -3'
Posted On2014-03-28