Incidental Mutation 'R1487:Olfr622'
ID163527
Institutional Source Beutler Lab
Gene Symbol Olfr622
Ensembl Gene ENSMUSG00000050085
Gene Nameolfactory receptor 622
SynonymsMOR26-1, GA_x6K02T2PBJ9-6362863-6361910
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103638451-103642702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103639594 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 182 (H182L)
Ref Sequence ENSEMBL: ENSMUSP00000151149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058744] [ENSMUST00000213536] [ENSMUST00000216570]
Predicted Effect probably damaging
Transcript: ENSMUST00000058744
AA Change: H182L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058312
Gene: ENSMUSG00000050085
AA Change: H182L

DomainStartEndE-ValueType
Pfam:7tm_4 32 312 4.2e-100 PFAM
Pfam:7TM_GPCR_Srsx 36 308 2.3e-6 PFAM
Pfam:7tm_1 42 293 6.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213536
AA Change: H182L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216337
Predicted Effect probably damaging
Transcript: ENSMUST00000216570
AA Change: H182L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Olfr622
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Olfr622 APN 7 103639832 missense probably damaging 1.00
IGL02972:Olfr622 APN 7 103639894 missense probably damaging 1.00
PIT4434001:Olfr622 UTSW 7 103639847 missense probably damaging 1.00
R1989:Olfr622 UTSW 7 103639495 missense probably damaging 1.00
R3880:Olfr622 UTSW 7 103639624 missense probably benign 0.33
R4595:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R4989:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R5715:Olfr622 UTSW 7 103639802 missense probably damaging 1.00
R5840:Olfr622 UTSW 7 103639256 missense probably benign 0.05
R6046:Olfr622 UTSW 7 103639679 missense probably benign 0.01
R6207:Olfr622 UTSW 7 103640002 missense probably benign 0.29
R6294:Olfr622 UTSW 7 103639591 missense probably damaging 1.00
R6392:Olfr622 UTSW 7 103639682 missense probably benign
R6522:Olfr622 UTSW 7 103639297 missense probably damaging 1.00
R6996:Olfr622 UTSW 7 103639858 missense probably benign 0.10
R7069:Olfr622 UTSW 7 103639960 missense probably damaging 0.99
R7251:Olfr622 UTSW 7 103639702 missense probably damaging 1.00
R7625:Olfr622 UTSW 7 103639958 missense probably damaging 1.00
X0018:Olfr622 UTSW 7 103639598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTGGGAAGAGAGCCGAAACAC -3'
(R):5'- GCACACTGGATCAACTTTGATGCC -3'

Sequencing Primer
(F):5'- CGAAACACTGACTGGAGGATTTTTAC -3'
(R):5'- TCATGGAGTCAGCCATCCTAGTAG -3'
Posted On2014-03-28