Incidental Mutation 'R1487:Nadsyn1'
ID163529
Institutional Source Beutler Lab
Gene Symbol Nadsyn1
Ensembl Gene ENSMUSG00000031090
Gene NameNAD synthetase 1
Synonyms9130012B15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location143795584-143822849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143806925 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 369 (V369I)
Ref Sequence ENSEMBL: ENSMUSP00000114380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033415] [ENSMUST00000132520] [ENSMUST00000156638]
Predicted Effect probably benign
Transcript: ENSMUST00000033415
AA Change: V369I

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033415
Gene: ENSMUSG00000031090
AA Change: V369I

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 283 3.2e-52 PFAM
Pfam:NAD_synthase 337 649 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132520
AA Change: V369I

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114380
Gene: ENSMUSG00000031090
AA Change: V369I

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 201 6.3e-39 PFAM
Pfam:NAD_synthase 336 561 8.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156638
SMART Domains Protein: ENSMUSP00000114889
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
SCOP:d1f89a_ 1 28 1e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in the biosynthesis of NAD from nicotinic acid adenine dinucleotide (NaAD).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Nadsyn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Nadsyn1 APN 7 143812793 missense probably damaging 1.00
IGL01359:Nadsyn1 APN 7 143821230 missense possibly damaging 0.74
IGL01412:Nadsyn1 APN 7 143808790 critical splice donor site probably null
IGL01481:Nadsyn1 APN 7 143812584 missense probably damaging 1.00
IGL01642:Nadsyn1 APN 7 143797878 missense probably damaging 1.00
IGL02110:Nadsyn1 APN 7 143813427 missense probably damaging 1.00
IGL02126:Nadsyn1 APN 7 143804016 nonsense probably null
IGL02173:Nadsyn1 APN 7 143804006 splice site probably benign
IGL02351:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL02358:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL03216:Nadsyn1 APN 7 143797845 missense probably damaging 1.00
R0029:Nadsyn1 UTSW 7 143806078 missense probably benign 0.01
R0036:Nadsyn1 UTSW 7 143811291 missense probably benign 0.23
R0968:Nadsyn1 UTSW 7 143806033 missense probably benign 0.30
R1694:Nadsyn1 UTSW 7 143808012 missense probably benign 0.00
R1874:Nadsyn1 UTSW 7 143797844 missense probably damaging 1.00
R4540:Nadsyn1 UTSW 7 143803223 missense probably damaging 1.00
R4742:Nadsyn1 UTSW 7 143798630 intron probably benign
R4755:Nadsyn1 UTSW 7 143806913 missense probably damaging 1.00
R5045:Nadsyn1 UTSW 7 143806969 missense probably damaging 1.00
R5288:Nadsyn1 UTSW 7 143803286 missense possibly damaging 0.95
R5326:Nadsyn1 UTSW 7 143808830 missense probably benign 0.42
R5666:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5669:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5691:Nadsyn1 UTSW 7 143812579 unclassified probably null
R5861:Nadsyn1 UTSW 7 143811227 missense possibly damaging 0.80
R6213:Nadsyn1 UTSW 7 143799812 missense probably benign 0.05
R6624:Nadsyn1 UTSW 7 143805973 missense probably benign 0.02
R6652:Nadsyn1 UTSW 7 143811218 missense probably benign 0.03
R6791:Nadsyn1 UTSW 7 143819108 missense probably damaging 1.00
R7144:Nadsyn1 UTSW 7 143811215 missense probably damaging 0.99
R7559:Nadsyn1 UTSW 7 143808067 missense probably benign 0.00
R7770:Nadsyn1 UTSW 7 143806003 missense probably damaging 1.00
R7802:Nadsyn1 UTSW 7 143806026 missense probably benign
R7871:Nadsyn1 UTSW 7 143798496 nonsense probably null
R7954:Nadsyn1 UTSW 7 143798496 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCCCCAGCAATGAAGCATCC -3'
(R):5'- TCTCCTGATGTGTGCTCACCGTAG -3'

Sequencing Primer
(F):5'- AGCAATGAAGCATCCCTCAC -3'
(R):5'- GTCCTTTAGGAAACCTCAGTCAG -3'
Posted On2014-03-28