Incidental Mutation 'R1487:Cdc16'
ID163531
Institutional Source Beutler Lab
Gene Symbol Cdc16
Ensembl Gene ENSMUSG00000038416
Gene NameCDC16 cell division cycle 16
Synonyms2810431D22Rik, 2700071J12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13757676-13781938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13771445 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 415 (N415K)
Ref Sequence ENSEMBL: ENSMUSP00000047950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043962] [ENSMUST00000130173]
Predicted Effect probably benign
Transcript: ENSMUST00000043962
AA Change: N415K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047950
Gene: ENSMUSG00000038416
AA Change: N415K

DomainStartEndE-ValueType
Pfam:TPR_9 11 63 1.8e-3 PFAM
Pfam:ANAPC3 15 95 3.5e-23 PFAM
TPR 130 163 1.17e1 SMART
Blast:TPR 299 333 2e-8 BLAST
Blast:TPR 334 367 1e-14 BLAST
TPR 368 401 1.48e1 SMART
Blast:TPR 402 435 7e-15 BLAST
TPR 445 478 6.68e-6 SMART
TPR 479 512 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130173
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Cdc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cdc16 APN 8 13767575 nonsense probably null
IGL01109:Cdc16 APN 8 13764606 missense probably benign 0.00
IGL01475:Cdc16 APN 8 13781542 missense probably benign
IGL02729:Cdc16 APN 8 13779250 missense possibly damaging 0.93
IGL03389:Cdc16 APN 8 13759179 missense probably damaging 1.00
R0026:Cdc16 UTSW 8 13759130 splice site probably null
R0373:Cdc16 UTSW 8 13779264 missense probably benign 0.04
R0520:Cdc16 UTSW 8 13760569 critical splice donor site probably null
R0564:Cdc16 UTSW 8 13781618 missense probably damaging 1.00
R1470:Cdc16 UTSW 8 13758992 splice site probably benign
R1753:Cdc16 UTSW 8 13764688 nonsense probably null
R1883:Cdc16 UTSW 8 13775738 missense probably damaging 1.00
R3087:Cdc16 UTSW 8 13759004 missense probably damaging 0.98
R3418:Cdc16 UTSW 8 13769489 nonsense probably null
R3756:Cdc16 UTSW 8 13777609 critical splice donor site probably null
R4152:Cdc16 UTSW 8 13762857 missense probably damaging 1.00
R4842:Cdc16 UTSW 8 13781644 utr 3 prime probably benign
R5122:Cdc16 UTSW 8 13764570 missense probably damaging 1.00
R5492:Cdc16 UTSW 8 13763915 splice site probably null
R5982:Cdc16 UTSW 8 13781399 missense possibly damaging 0.73
R6145:Cdc16 UTSW 8 13767573 missense possibly damaging 0.96
R6154:Cdc16 UTSW 8 13768609 missense possibly damaging 0.87
R6611:Cdc16 UTSW 8 13781512 missense probably benign
R6992:Cdc16 UTSW 8 13759188 missense probably benign 0.22
R7011:Cdc16 UTSW 8 13769451 missense probably damaging 1.00
R7484:Cdc16 UTSW 8 13777605 missense probably benign 0.01
R7593:Cdc16 UTSW 8 13777605 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTTCAGGTGTCACTTGCCAATGC -3'
(R):5'- AAGAAGATGTTGTCCAGACCACATGG -3'

Sequencing Primer
(F):5'- CCCAGAAGACCCATTTGTCA -3'
(R):5'- GTTTGTGCAGCCCATATTAAAGGAG -3'
Posted On2014-03-28