Incidental Mutation 'R1487:Setd6'
ID163536
Institutional Source Beutler Lab
Gene Symbol Setd6
Ensembl Gene ENSMUSG00000031671
Gene NameSET domain containing 6
Synonyms0610039J04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95715881-95719010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95717928 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 83 (L83H)
Ref Sequence ENSEMBL: ENSMUSP00000148785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034096] [ENSMUST00000041318] [ENSMUST00000068452] [ENSMUST00000073139] [ENSMUST00000080666] [ENSMUST00000098473] [ENSMUST00000141900] [ENSMUST00000148727] [ENSMUST00000162578] [ENSMUST00000166358] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably damaging
Transcript: ENSMUST00000034096
AA Change: L267H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034096
Gene: ENSMUSG00000031671
AA Change: L267H

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SET 62 293 1.84e0 SMART
Pfam:Rubis-subs-bind 330 465 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041318
SMART Domains Protein: ENSMUSP00000036226
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ndr 60 342 3.1e-126 PFAM
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068452
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073139
SMART Domains Protein: ENSMUSP00000072883
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 2e-126 PFAM
Pfam:Abhydrolase_6 43 278 1.2e-16 PFAM
low complexity region 308 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080666
SMART Domains Protein: ENSMUSP00000079495
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 9.9e-127 PFAM
Pfam:Abhydrolase_6 43 278 1.1e-16 PFAM
low complexity region 295 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098473
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126888
Predicted Effect probably benign
Transcript: ENSMUST00000141900
Predicted Effect probably damaging
Transcript: ENSMUST00000148727
AA Change: L83H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161314
Predicted Effect probably benign
Transcript: ENSMUST00000162578
Predicted Effect probably benign
Transcript: ENSMUST00000166358
SMART Domains Protein: ENSMUSP00000131203
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212302
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that adds a methyl group to the histone H2AZ, which is involved in nuclear receptor-dependent transcription. The protein also interacts with several endogenous proteins which are involved in nuclear hormone receptor signaling. A related pseudogene is located on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Setd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Setd6 APN 8 95716692 missense probably damaging 1.00
IGL02984:Setd6 UTSW 8 95716275 splice site probably null
R0021:Setd6 UTSW 8 95716665 missense probably damaging 1.00
R0140:Setd6 UTSW 8 95716109 missense probably damaging 1.00
R2073:Setd6 UTSW 8 95716788 missense probably damaging 1.00
R4672:Setd6 UTSW 8 95718012 missense probably null 0.11
R4817:Setd6 UTSW 8 95717055 unclassified probably benign
R5960:Setd6 UTSW 8 95716199 missense probably damaging 1.00
R7775:Setd6 UTSW 8 95716238 missense probably benign 0.05
R7778:Setd6 UTSW 8 95716238 missense probably benign 0.05
R7824:Setd6 UTSW 8 95716238 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGCCCATAGCTTCCAGTTTTCG -3'
(R):5'- ACCATCTGAATGTCAGCCGTGTC -3'

Sequencing Primer
(F):5'- TCTCCAGTGTAAGCAGATGTGAC -3'
(R):5'- AATGTCAGCCGTGTCGTCTG -3'
Posted On2014-03-28