Incidental Mutation 'R1487:Olfr784'
ID163543
Institutional Source Beutler Lab
Gene Symbol Olfr784
Ensembl Gene ENSMUSG00000094347
Gene Nameolfactory receptor 784
SynonymsGA_x6K02T2PULF-11068246-11069205, MOR110-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129384083-129390198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129388340 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 236 (F236L)
Ref Sequence ENSEMBL: ENSMUSP00000149354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082342] [ENSMUST00000214064]
Predicted Effect probably benign
Transcript: ENSMUST00000082342
AA Change: F236L

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080953
Gene: ENSMUSG00000094347
AA Change: F236L

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.3e-51 PFAM
Pfam:7tm_1 39 288 3.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214064
AA Change: F236L

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Olfr784
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Olfr784 APN 10 129388104 missense probably benign 0.03
IGL03096:Olfr784 APN 10 129388449 missense probably damaging 0.96
IGL03365:Olfr784 APN 10 129388239 missense possibly damaging 0.94
R0645:Olfr784 UTSW 10 129388293 missense possibly damaging 0.88
R1104:Olfr784 UTSW 10 129388221 missense probably benign 0.31
R1456:Olfr784 UTSW 10 129387783 missense probably damaging 0.98
R1526:Olfr784 UTSW 10 129388307 missense probably benign 0.01
R1860:Olfr784 UTSW 10 129388086 missense probably damaging 1.00
R1930:Olfr784 UTSW 10 129387876 missense probably benign
R1931:Olfr784 UTSW 10 129387876 missense probably benign
R4623:Olfr784 UTSW 10 129388046 missense probably benign 0.11
R5385:Olfr784 UTSW 10 129387764 missense probably benign 0.05
R5483:Olfr784 UTSW 10 129387657 missense probably benign 0.02
R5780:Olfr784 UTSW 10 129388070 missense probably damaging 1.00
R6448:Olfr784 UTSW 10 129388152 missense probably damaging 1.00
R6956:Olfr784 UTSW 10 129388297 missense probably benign 0.04
R7102:Olfr784 UTSW 10 129388167 missense probably damaging 0.99
R7584:Olfr784 UTSW 10 129388032 missense probably damaging 0.99
R7626:Olfr784 UTSW 10 129387857 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCAAAGTGTGCCATCTACTGGTTC -3'
(R):5'- GTTTGAAAGCATCCTTCACCTGCTG -3'

Sequencing Primer
(F):5'- ACTCTTGGGACTCAAACTGG -3'
(R):5'- TTCACCTGCTGGTTCCTTAG -3'
Posted On2014-03-28