Incidental Mutation 'R1487:Chrna2'
ID163553
Institutional Source Beutler Lab
Gene Symbol Chrna2
Ensembl Gene ENSMUSG00000022041
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)
SynonymsAcra-2, Acra2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location66135039-66152948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66143363 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 27 (A27V)
Ref Sequence ENSEMBL: ENSMUSP00000145896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000206455]
Predicted Effect probably benign
Transcript: ENSMUST00000022620
AA Change: A27V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041
AA Change: A27V

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206455
AA Change: A27V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels formed by a pentameric arrangement of alpha and beta subunits to create distinct muscle and neuronal receptors. Neuronal receptors are found throughout the peripheral and central nervous system where they are involved in fast synaptic transmission. This gene encodes an alpha subunit that is widely expressed in the brain. The proposed structure for nAChR subunits is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. Mutations in this gene cause autosomal dominant nocturnal frontal lobe epilepsy type 4. Single nucleotide polymorphisms (SNPs) in this gene have been associated with nicotine dependence. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Chrna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Chrna2 APN 14 66149440 missense probably benign 0.01
IGL03172:Chrna2 APN 14 66142239 missense probably benign
IGL03268:Chrna2 APN 14 66150946 splice site probably benign
IGL03344:Chrna2 APN 14 66150966 missense probably damaging 0.99
PIT1430001:Chrna2 UTSW 14 66149737 missense probably benign 0.01
R0511:Chrna2 UTSW 14 66149104 missense probably damaging 1.00
R0631:Chrna2 UTSW 14 66149308 missense probably benign 0.45
R1205:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1485:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1513:Chrna2 UTSW 14 66143429 missense probably benign 0.13
R2023:Chrna2 UTSW 14 66142228 missense probably benign 0.25
R2094:Chrna2 UTSW 14 66149463 missense possibly damaging 0.65
R2964:Chrna2 UTSW 14 66149368 missense possibly damaging 0.82
R2966:Chrna2 UTSW 14 66149368 missense possibly damaging 0.82
R3118:Chrna2 UTSW 14 66150993 missense probably damaging 0.98
R3931:Chrna2 UTSW 14 66149767 missense probably benign 0.26
R3979:Chrna2 UTSW 14 66148953 missense probably damaging 1.00
R3983:Chrna2 UTSW 14 66149457 missense probably benign 0.00
R4080:Chrna2 UTSW 14 66143417 missense probably benign 0.12
R4080:Chrna2 UTSW 14 66143424 nonsense probably null
R4508:Chrna2 UTSW 14 66146453 missense probably damaging 1.00
R4661:Chrna2 UTSW 14 66148843 missense probably damaging 1.00
R4726:Chrna2 UTSW 14 66148896 missense possibly damaging 0.85
R5349:Chrna2 UTSW 14 66143507 missense probably damaging 0.99
R5787:Chrna2 UTSW 14 66149008 missense probably benign 0.16
R6967:Chrna2 UTSW 14 66150949 critical splice acceptor site probably null
R7218:Chrna2 UTSW 14 66143871 intron probably null
R7274:Chrna2 UTSW 14 66149226 missense probably benign 0.03
R7565:Chrna2 UTSW 14 66151035 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCGTTAAGCACCAATCTGCG -3'
(R):5'- TTCCTCAGGGTCACCCAATCACAG -3'

Sequencing Primer
(F):5'- ACCAATCTGCGTTAATCTATGGGG -3'
(R):5'- GTTTTAGACAACCTATGCTCTTGG -3'
Posted On2014-03-28