Incidental Mutation 'R1487:Zfp799'
ID163564
Institutional Source Beutler Lab
Gene Symbol Zfp799
Ensembl Gene ENSMUSG00000095253
Gene Namezinc finger protein 799
Synonyms6030490I01Rik
Accession Numbers

NCBI RefSeq: NM_177359.4; MGI:2443934

Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32815449-32830261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32820677 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 204 (T204N)
Ref Sequence ENSEMBL: ENSMUSP00000136298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179695] [ENSMUST00000201499] [ENSMUST00000201876] [ENSMUST00000202759] [ENSMUST00000202988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000179695
AA Change: T204N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136298
Gene: ENSMUSG00000095253
AA Change: T204N

DomainStartEndE-ValueType
KRAB 3 60 1.22e-9 SMART
low complexity region 97 110 N/A INTRINSIC
ZnF_C2H2 194 216 1.2e-3 SMART
ZnF_C2H2 222 244 1.28e-3 SMART
ZnF_C2H2 250 272 4.87e-4 SMART
ZnF_C2H2 278 300 9.08e-4 SMART
ZnF_C2H2 306 328 2.27e-4 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 360 382 4.34e-1 SMART
ZnF_C2H2 388 410 1.84e-4 SMART
ZnF_C2H2 416 438 9.58e-3 SMART
ZnF_C2H2 444 466 6.32e-3 SMART
ZnF_C2H2 472 494 2.95e-3 SMART
ZnF_C2H2 500 522 2.2e-2 SMART
ZnF_C2H2 528 550 1.56e-2 SMART
ZnF_C2H2 556 578 2.4e-3 SMART
ZnF_C2H2 584 606 2.53e-2 SMART
ZnF_C2H2 612 634 4.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181318
Predicted Effect probably benign
Transcript: ENSMUST00000201499
SMART Domains Protein: ENSMUSP00000143907
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201876
SMART Domains Protein: ENSMUSP00000144187
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 5.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202759
SMART Domains Protein: ENSMUSP00000144087
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 63 5.6e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202988
AA Change: T205N

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144480
Gene: ENSMUSG00000095253
AA Change: T205N

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
low complexity region 98 111 N/A INTRINSIC
ZnF_C2H2 195 217 1.2e-3 SMART
ZnF_C2H2 223 245 1.28e-3 SMART
ZnF_C2H2 251 273 4.87e-4 SMART
ZnF_C2H2 279 301 9.08e-4 SMART
ZnF_C2H2 307 329 2.27e-4 SMART
ZnF_C2H2 335 357 1.53e-1 SMART
ZnF_C2H2 361 383 4.34e-1 SMART
ZnF_C2H2 389 411 1.84e-4 SMART
ZnF_C2H2 417 439 9.58e-3 SMART
ZnF_C2H2 445 467 6.32e-3 SMART
ZnF_C2H2 473 495 2.95e-3 SMART
ZnF_C2H2 501 523 2.2e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.4e-3 SMART
ZnF_C2H2 585 607 2.53e-2 SMART
ZnF_C2H2 613 635 4.47e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Other mutations in Zfp799
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Zfp799 APN 17 32821820 missense possibly damaging 0.73
P0016:Zfp799 UTSW 17 32819357 missense possibly damaging 0.79
R0116:Zfp799 UTSW 17 32821035 missense possibly damaging 0.96
R0326:Zfp799 UTSW 17 32820726 missense possibly damaging 0.73
R1863:Zfp799 UTSW 17 32819400 missense probably damaging 1.00
R1929:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R1983:Zfp799 UTSW 17 32822110 missense probably damaging 1.00
R2127:Zfp799 UTSW 17 32819498 missense possibly damaging 0.80
R2271:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R2697:Zfp799 UTSW 17 32820240 nonsense probably null
R5134:Zfp799 UTSW 17 32820441 missense probably damaging 1.00
R5613:Zfp799 UTSW 17 32819990 missense probably damaging 0.98
R5839:Zfp799 UTSW 17 32822112 missense probably null 0.99
R6389:Zfp799 UTSW 17 32820578 missense probably damaging 1.00
R6414:Zfp799 UTSW 17 32820285 missense probably damaging 1.00
R6475:Zfp799 UTSW 17 32820846 missense probably damaging 0.99
R6593:Zfp799 UTSW 17 32819790 missense probably damaging 1.00
R7133:Zfp799 UTSW 17 32820236 missense probably benign 0.19
R7543:Zfp799 UTSW 17 32820560 missense probably benign 0.11
R7883:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7889:Zfp799 UTSW 17 32819499 nonsense probably null
R7966:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7972:Zfp799 UTSW 17 32819499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCACACTGCTTACACATATAGGGC -3'
(R):5'- CGAAGGTCATCAGCGTGCAGAAATC -3'

Sequencing Primer
(F):5'- gcttacacatatagggcttctcac -3'
(R):5'- ATCTTTAACTGGACCCCAGAGTG -3'
Posted On2014-03-28