Incidental Mutation 'R1487:B4galt6'
ID163566
Institutional Source Beutler Lab
Gene Symbol B4galt6
Ensembl Gene ENSMUSG00000056124
Gene NameUDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20684599-20746404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20706514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 121 (V121A)
Ref Sequence ENSEMBL: ENSMUSP00000066515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070080]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070080
AA Change: V121A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066515
Gene: ENSMUSG00000056124
AA Change: V121A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 108 243 3.3e-56 PFAM
Pfam:Glyco_transf_7C 247 325 2e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene is a lactosylceramide synthase important for glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype with reduced lactosylceramide synthase in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in B4galt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:B4galt6 APN 18 20689013 missense probably damaging 0.98
IGL02260:B4galt6 APN 18 20700747 missense probably benign 0.00
H8786:B4galt6 UTSW 18 20688944 missense probably benign 0.10
PIT4515001:B4galt6 UTSW 18 20688467 missense probably benign 0.01
R0578:B4galt6 UTSW 18 20727956 splice site probably benign
R1259:B4galt6 UTSW 18 20706502 missense possibly damaging 0.82
R1471:B4galt6 UTSW 18 20745353 missense possibly damaging 0.50
R1689:B4galt6 UTSW 18 20706496 missense probably benign 0.05
R4541:B4galt6 UTSW 18 20745439 missense probably benign 0.04
R4845:B4galt6 UTSW 18 20688460 missense probably benign 0.20
R4968:B4galt6 UTSW 18 20727969 missense possibly damaging 0.81
R5379:B4galt6 UTSW 18 20689239 missense probably damaging 1.00
R5503:B4galt6 UTSW 18 20745352 critical splice donor site probably null
R6755:B4galt6 UTSW 18 20689329 missense probably benign 0.01
R7296:B4galt6 UTSW 18 20728042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGGACCCAACTGAAAACAAGG -3'
(R):5'- AGGAGTAGCCCATACTGTCCATCAC -3'

Sequencing Primer
(F):5'- CTCTCAGTTCCAGAAACTGGTGG -3'
(R):5'- ATCACTCTGTGACTGATGCTG -3'
Posted On2014-03-28