Incidental Mutation 'R1487:Nrg2'
ID163567
Institutional Source Beutler Lab
Gene Symbol Nrg2
Ensembl Gene ENSMUSG00000060275
Gene Nameneuregulin 2
SynonymsNTAK, Don1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36017707-36197380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36052912 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 258 (G258E)
Ref Sequence ENSEMBL: ENSMUSP00000111378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115713]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115705
SMART Domains Protein: ENSMUSP00000111370
Gene: ENSMUSG00000060275

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
IGc2 105 175 3.85e-14 SMART
EGF 201 239 3.76e-1 SMART
low complexity region 265 274 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115712
AA Change: G78E
SMART Domains Protein: ENSMUSP00000111377
Gene: ENSMUSG00000060275
AA Change: G78E

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 1.66e-2 SMART
Pfam:Neuregulin 403 834 1.7e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115713
AA Change: G258E

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111378
Gene: ENSMUSG00000060275
AA Change: G258E

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 3.76e-1 SMART
Pfam:Neuregulin 409 844 4.4e-170 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: About one third of mice homozygous for a knock-out allele die prior to weaning in the absence of cardiac defects or other morphological abnormalities. Homozygotes display an early but transient postnatal growth deficit and reduced reproductive capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Nrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nrg2 APN 18 36021218 missense probably benign 0.00
IGL01396:Nrg2 APN 18 36045852 splice site probably benign
R0179:Nrg2 UTSW 18 36022415 missense probably benign 0.13
R0976:Nrg2 UTSW 18 36021091 missense probably benign 0.21
R1387:Nrg2 UTSW 18 36196739 missense probably damaging 1.00
R1746:Nrg2 UTSW 18 36021922 missense probably damaging 1.00
R1882:Nrg2 UTSW 18 36021097 missense probably damaging 1.00
R1940:Nrg2 UTSW 18 36196844 unclassified probably benign
R2090:Nrg2 UTSW 18 36018443 missense probably benign 0.00
R2183:Nrg2 UTSW 18 36196751 missense probably benign 0.11
R4664:Nrg2 UTSW 18 36052895 missense possibly damaging 0.87
R4677:Nrg2 UTSW 18 36021099 missense possibly damaging 0.92
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R5091:Nrg2 UTSW 18 36052785 missense probably damaging 1.00
R6657:Nrg2 UTSW 18 36196589 missense probably damaging 0.98
R6968:Nrg2 UTSW 18 36196446 missense probably benign 0.01
R7186:Nrg2 UTSW 18 36045920 missense probably benign 0.17
R7304:Nrg2 UTSW 18 36045941 missense probably benign 0.24
R7467:Nrg2 UTSW 18 36022406 missense probably benign 0.00
R7564:Nrg2 UTSW 18 36024396 missense probably damaging 1.00
R7876:Nrg2 UTSW 18 36197087 missense unknown
Z1176:Nrg2 UTSW 18 36018470 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCTGAAGTCAGGGGAGCATTGG -3'
(R):5'- CGCAGACTCTAAATGTGGGCTGAG -3'

Sequencing Primer
(F):5'- CATTGGGATGTGGCAAGGC -3'
(R):5'- GGCTGAGTTGGGCTAAAGAC -3'
Posted On2014-03-28