Incidental Mutation 'R1487:Cd14'
ID163568
Institutional Source Beutler Lab
Gene Symbol Cd14
Ensembl Gene ENSMUSG00000051439
Gene NameCD14 antigen
Synonymsmonocyte differentiation antigen CD14; myeloid cell-specific leucine-rich glycoprotein
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1487 (G1)
Quality Score207
Status Not validated
Chromosome18
Chromosomal Location36725074-36726736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36725484 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 306 (N306S)
Ref Sequence ENSEMBL: ENSMUSP00000056669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061829]
PDB Structure
Crystal structure of CD14 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000061829
AA Change: N306S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056669
Gene: ENSMUSG00000051439
AA Change: N306S

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:1WWL|B 18 329 N/A PDB
SCOP:d1fqva2 86 326 1e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that plays an important role in the innate immune response and is expressed in monocyte/macrophage cells. This gene product acts as a co-receptor that binds several microbial and fungal molecules, including lipopolysaccharides (LPS). This proteins LPS-binding activity is enhanced by the LPS binding protein (LBP) to allow binding to the TLR4-MD-2 co-receptor complex. The product of this gene is found in two forms, either as a soluble protein or attached to the cell surface by a glycosylphosphatidylinositol anchor. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice exhibit macrophages with impaired responses to LPS or E.coli, resulting in a reduction or loss of cytokine production. Macrophages also cannot contain vesicular stomatitis virus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
9130011E15Rik A C 19: 45,940,443 probably null Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in Cd14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Cd14 APN 18 36725640 missense possibly damaging 0.91
IGL02164:Cd14 APN 18 36725785 missense possibly damaging 0.47
IGL02237:Cd14 APN 18 36725859 missense probably damaging 1.00
IGL02834:Cd14 APN 18 36725503 missense probably benign 0.13
IGL02981:Cd14 APN 18 36726479 splice site probably benign
heedless UTSW 18 36726171 missense probably benign 0.01
R0034:Cd14 UTSW 18 36726235 missense probably benign
R1612:Cd14 UTSW 18 36725665 nonsense probably null
R1754:Cd14 UTSW 18 36725514 missense probably damaging 1.00
R1773:Cd14 UTSW 18 36725304 missense possibly damaging 0.59
R1964:Cd14 UTSW 18 36726339 missense probably damaging 1.00
R5579:Cd14 UTSW 18 36726235 missense probably benign
R6006:Cd14 UTSW 18 36726282 missense possibly damaging 0.51
R6114:Cd14 UTSW 18 36725953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGCCAGAGTTCCTGACAAG -3'
(R):5'- CTGACAATCCTGAATTGGGCGAGAG -3'

Sequencing Primer
(F):5'- AGTTCCTGACAAGGCCACTG -3'
(R):5'- AGAGAGGACTGATCTCAGCCC -3'
Posted On2014-03-28