Incidental Mutation 'R1487:9130011E15Rik'
ID163571
Institutional Source Beutler Lab
Gene Symbol 9130011E15Rik
Ensembl Gene ENSMUSG00000039901
Gene NameRIKEN cDNA 9130011E15 gene
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1487 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45818144-45998488 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 45940443 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045396] [ENSMUST00000045396]
Predicted Effect probably null
Transcript: ENSMUST00000045396
SMART Domains Protein: ENSMUSP00000048454
Gene: ENSMUSG00000039901

DomainStartEndE-ValueType
low complexity region 155 167 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
DUF1741 435 671 5.65e-139 SMART
Predicted Effect probably null
Transcript: ENSMUST00000045396
SMART Domains Protein: ENSMUSP00000048454
Gene: ENSMUSG00000039901

DomainStartEndE-ValueType
low complexity region 155 167 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
DUF1741 435 671 5.65e-139 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A C 6: 146,953,379 V55G probably benign Het
2410089E03Rik C T 15: 8,186,231 R424W probably damaging Het
Abhd13 A G 8: 9,987,402 probably benign Het
Arid5b T A 10: 68,097,214 K953* probably null Het
Armc4 A T 18: 7,273,245 Y282N probably damaging Het
B4galt6 A G 18: 20,706,514 V121A possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Calu A G 6: 29,366,956 I208V probably benign Het
Cd14 T C 18: 36,725,484 N306S probably benign Het
Cdc16 T A 8: 13,771,445 N415K probably benign Het
Cfap57 C A 4: 118,614,781 V134F probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Chtf18 T C 17: 25,720,609 K67R probably benign Het
Clock T C 5: 76,266,354 probably null Het
Eif4g1 G A 16: 20,678,873 probably benign Het
Eps8l2 A T 7: 141,361,618 M601L probably benign Het
Fat4 A G 3: 38,995,917 E3976G possibly damaging Het
Flrt3 T A 2: 140,660,934 H258L probably damaging Het
Flt4 C A 11: 49,633,144 T517K possibly damaging Het
Galnt7 T C 8: 57,540,039 N416S probably damaging Het
Gipc1 C T 8: 83,661,179 Q63* probably null Het
Gm17079 A T 14: 51,693,085 probably null Het
Gucy2c T A 6: 136,748,826 I375F possibly damaging Het
Hps4 C T 5: 112,377,999 Q629* probably null Het
Hunk A G 16: 90,386,637 Y61C probably damaging Het
Itga6 T C 2: 71,843,240 S873P possibly damaging Het
Kcnc1 A G 7: 46,397,874 H66R possibly damaging Het
Kcnc1 T C 7: 46,435,348 probably null Het
Khdc3 A G 9: 73,102,564 T19A probably benign Het
Kmt2a T C 9: 44,833,990 probably benign Het
Lipe C T 7: 25,384,815 A615T possibly damaging Het
Lrguk A T 6: 34,062,360 M269L probably benign Het
Lrrc18 A G 14: 33,008,683 N60D probably damaging Het
Magi1 T C 6: 93,708,079 T773A probably benign Het
Map3k14 T A 11: 103,225,337 D755V possibly damaging Het
Mecom T C 3: 29,980,064 T488A probably damaging Het
Mmp10 T G 9: 7,509,977 W473G probably damaging Het
Mrgpra2a C T 7: 47,426,686 V275I probably benign Het
Myo7a A C 7: 98,053,810 probably null Het
Nadsyn1 C T 7: 143,806,925 V369I probably benign Het
Nptxr C A 15: 79,789,903 G424V probably damaging Het
Nrg2 C T 18: 36,052,912 G258E possibly damaging Het
Nup210 G A 6: 91,042,576 P221S probably damaging Het
Olfr622 T A 7: 103,639,594 H182L probably damaging Het
Olfr784 T C 10: 129,388,340 F236L probably benign Het
Oxct1 A G 15: 4,147,575 D477G possibly damaging Het
Pcdh8 G T 14: 79,769,547 D525E probably damaging Het
Phldb2 A G 16: 45,789,024 S740P probably damaging Het
Prss54 A G 8: 95,559,648 S266P probably benign Het
Ptprh T A 7: 4,552,738 I741F probably damaging Het
Rab11fip1 G T 8: 27,154,212 S515Y probably damaging Het
Recql4 T A 15: 76,708,983 N309I probably benign Het
Sec24a T C 11: 51,731,886 T388A possibly damaging Het
Setd6 T A 8: 95,717,928 L83H probably damaging Het
Slc6a12 G A 6: 121,363,757 W534* probably null Het
St14 C T 9: 31,097,180 C488Y probably damaging Het
Supt16 A G 14: 52,176,608 probably null Het
Tanc2 A G 11: 105,923,634 Y1968C probably damaging Het
Tcaim T A 9: 122,818,832 Y137* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm3 A T 3: 90,090,082 probably null Het
Trip12 A T 1: 84,768,631 N475K probably damaging Het
Twnk G T 19: 45,008,376 probably null Het
Zfp287 T C 11: 62,725,289 K192R probably damaging Het
Zfp799 G T 17: 32,820,677 T204N possibly damaging Het
Other mutations in 9130011E15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:9130011E15Rik APN 19 45940488 missense probably benign 0.19
IGL00788:9130011E15Rik APN 19 45932350 critical splice donor site probably null
IGL01356:9130011E15Rik APN 19 45966303 missense possibly damaging 0.94
IGL01477:9130011E15Rik APN 19 45978604 missense probably damaging 0.99
IGL01660:9130011E15Rik APN 19 45940476 missense probably damaging 1.00
IGL02193:9130011E15Rik APN 19 45972884 missense probably benign 0.02
IGL02863:9130011E15Rik APN 19 45958411 missense probably damaging 1.00
IGL03108:9130011E15Rik APN 19 45820353 missense probably damaging 0.99
R0035:9130011E15Rik UTSW 19 45891240 missense probably damaging 1.00
R0791:9130011E15Rik UTSW 19 45933868 splice site probably null
R0792:9130011E15Rik UTSW 19 45933868 splice site probably null
R1843:9130011E15Rik UTSW 19 45975252 missense probably benign 0.17
R2061:9130011E15Rik UTSW 19 45978667 missense probably damaging 1.00
R2070:9130011E15Rik UTSW 19 45891285 missense probably damaging 1.00
R2072:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2073:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2074:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2091:9130011E15Rik UTSW 19 45952680 missense probably damaging 1.00
R2263:9130011E15Rik UTSW 19 45932349 critical splice donor site probably null
R2863:9130011E15Rik UTSW 19 45885957 missense probably damaging 1.00
R3236:9130011E15Rik UTSW 19 45975283 splice site probably benign
R3796:9130011E15Rik UTSW 19 45921610 splice site probably benign
R4044:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R4716:9130011E15Rik UTSW 19 45960342 missense probably damaging 1.00
R4974:9130011E15Rik UTSW 19 45820287 missense probably damaging 1.00
R4983:9130011E15Rik UTSW 19 45950707 missense probably benign
R5063:9130011E15Rik UTSW 19 45885955 missense possibly damaging 0.95
R5313:9130011E15Rik UTSW 19 45818975 missense probably damaging 1.00
R5782:9130011E15Rik UTSW 19 45886027 missense probably benign 0.08
R5985:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R6220:9130011E15Rik UTSW 19 45846115 missense possibly damaging 0.79
R6379:9130011E15Rik UTSW 19 45921697 missense possibly damaging 0.46
R6674:9130011E15Rik UTSW 19 45974998 missense probably benign 0.06
R6842:9130011E15Rik UTSW 19 45818977 missense probably benign 0.05
R6890:9130011E15Rik UTSW 19 45960357 missense probably damaging 1.00
R7034:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7036:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7305:9130011E15Rik UTSW 19 45892121 missense probably benign 0.35
R7411:9130011E15Rik UTSW 19 45965435 missense probably benign 0.00
R7762:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
X0060:9130011E15Rik UTSW 19 45932393 missense possibly damaging 0.95
Z1088:9130011E15Rik UTSW 19 45818905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATAGAGTACCAGCCAGAACCAC -3'
(R):5'- TGGAGTGTGAACTACAATTGCTCCTG -3'

Sequencing Primer
(F):5'- tccagccttgccacaaac -3'
(R):5'- CTACAATTGCTCCTGTTGATGATG -3'
Posted On2014-03-28