Mutagenetix > Incidental Mutation

Incidental Mutation 'R1489:Gm8251'

163573

Institutional Source

Beutler Lab

Gene Symbol

Gm8251

Ensembl Gene

ENSMUSG00000091844

Gene Name

predicted gene 8251

Synonyms

MMRRC Submission

039541-MU

Accession Numbers

Genbank: XM_985572; MGI: 3647616

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R1489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44055952-44061936 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44061507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 144 (I144V)

Ref Sequence

ENSEMBL: ENSMUSP00000127017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000168641
AA Change: I144V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: I144V

Domain	Start	End	E-Value	Type
Pfam:CCDC168_N	2	202	2.5e-83	PFAM
Pfam:CCDC168_N	200	302	1.7e-26	PFAM
Pfam:CCDC168_N	347	397	2.1e-4	PFAM
Pfam:CCDC168_N	437	581	8.5e-8	PFAM
Pfam:CCDC168_N	663	802	6.3e-5	PFAM
Pfam:CCDC168_N	788	955	1e-9	PFAM
low complexity region	1803	1819	N/A	INTRINSIC
low complexity region	1830	1847	N/A	INTRINSIC
low complexity region	1968	1984	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Adam6b	T	A	12: 113,491,451	S629R	probably benign	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Armc3	A	T	2: 19,310,047	Y856F	probably benign	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
Atxn2l	A	T	7: 126,496,467	S379T	probably damaging	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cap2	A	T	13: 46,609,635	I114F	probably damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Duox2	T	A	2: 122,293,396	M436L	probably benign	Het
Exoc6	T	A	19: 37,597,120	M481K	possibly damaging	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Pdzrn4	T	C	15: 92,677,712	L333P	probably benign	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Virma	T	C	4: 11,521,164	V907A	probably damaging	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Gm8251

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
D3080:Gm8251	UTSW	1	44067335
R0045:Gm8251	UTSW	1	44057205	missense	probably benign
R0110:Gm8251	UTSW	1	44059224	missense	probably benign
R0450:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0469:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0510:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0602:Gm8251	UTSW	1	44059967	missense	possibly damaging	0.96
R0648:Gm8251	UTSW	1	44056563	missense	possibly damaging	0.73
R0928:Gm8251	UTSW	1	44057228	missense	possibly damaging	0.73
R1056:Gm8251	UTSW	1	44060927	missense	probably damaging	1.00
R1217:Gm8251	UTSW	1	44057179	missense	possibly damaging	0.73
R1232:Gm8251	UTSW	1	44056592	missense	possibly damaging	0.96
R1399:Gm8251	UTSW	1	44061311	missense	possibly damaging	0.93
R1489:Gm8251	UTSW	1	44057790	missense	probably benign	0.18
R1519:Gm8251	UTSW	1	44056970	missense	probably benign	0.33
R1664:Gm8251	UTSW	1	44059227	missense	possibly damaging	0.71
R1828:Gm8251	UTSW	1	44057074	missense	possibly damaging	0.72
R1944:Gm8251	UTSW	1	44061849	missense	probably damaging	0.97
R2032:Gm8251	UTSW	1	44061740	missense	possibly damaging	0.86
R2094:Gm8251	UTSW	1	44059730	missense	probably benign	0.06
R2170:Gm8251	UTSW	1	44056008	missense	probably benign	0.18
R2185:Gm8251	UTSW	1	44061381	missense	probably benign	0.01
R2280:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2281:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2339:Gm8251	UTSW	1	44060863	missense	probably benign
R3617:Gm8251	UTSW	1	44060954	missense	probably benign
R3738:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4012:Gm8251	UTSW	1	44060969	missense	possibly damaging	0.85
R4034:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4344:Gm8251	UTSW	1	44060991	missense	possibly damaging	0.86
R4436:Gm8251	UTSW	1	44056116	missense	probably benign	0.03
R4485:Gm8251	UTSW	1	44060123	missense	probably benign
R4735:Gm8251	UTSW	1	44061701	missense	probably benign
R4782:Gm8251	UTSW	1	44059043	missense	possibly damaging	0.85
R4837:Gm8251	UTSW	1	44061434	missense	possibly damaging	0.93
R4862:Gm8251	UTSW	1	44058018	missense	possibly damaging	0.93
R5247:Gm8251	UTSW	1	44057006	nonsense	probably null
R5347:Gm8251	UTSW	1	44057795	missense	probably benign	0.01
R5355:Gm8251	UTSW	1	44057979	missense	possibly damaging	0.53
R5559:Gm8251	UTSW	1	44058515	missense	possibly damaging	0.77
R5640:Gm8251	UTSW	1	44061927	missense	probably benign	0.00
R5681:Gm8251	UTSW	1	44061464	missense	possibly damaging	0.93
R5776:Gm8251	UTSW	1	44056505	missense	possibly damaging	0.72
R5919:Gm8251	UTSW	1	44056986	missense	probably benign
R5987:Gm8251	UTSW	1	44057257	missense	probably benign
R6616:Gm8251	UTSW	1	44061474	missense	possibly damaging	0.51
R6677:Gm8251	UTSW	1	44058699	missense	probably benign	0.00
R6830:Gm8251	UTSW	1	44056730	missense	probably benign	0.33
R6906:Gm8251	UTSW	1	44056013	missense	probably benign	0.33
R6909:Gm8251	UTSW	1	44059775	missense	possibly damaging	0.71
R6957:Gm8251	UTSW	1	44057207	missense	probably benign	0.00
R7008:Gm8251	UTSW	1	44059625	missense	probably benign
R7052:Gm8251	UTSW	1	44057306	missense	possibly damaging	0.53
R7176:Gm8251	UTSW	1	44060346	missense	probably benign	0.00
R7190:Gm8251	UTSW	1	44061615	missense	probably benign	0.32
R7296:Gm8251	UTSW	1	44060916	nonsense	probably null
R7347:Gm8251	UTSW	1	44059496	missense	probably damaging	0.99
R7371:Gm8251	UTSW	1	44061377	missense	probably benign
R7375:Gm8251	UTSW	1	44060534	missense	possibly damaging	0.53
R7442:Gm8251	UTSW	1	44058708	missense	possibly damaging	0.84
R7450:Gm8251	UTSW	1	44058773	missense	probably benign	0.33
R7574:Gm8251	UTSW	1	44059433	missense	possibly damaging	0.93
R7586:Gm8251	UTSW	1	44060013	missense	probably benign	0.20
R7739:Gm8251	UTSW	1	44056418	missense	possibly damaging	0.86
R7878:Gm8251	UTSW	1	44056014	missense	probably benign	0.18
R7959:Gm8251	UTSW	1	44057568	missense	probably benign
R7991:Gm8251	UTSW	1	44059709	missense	probably benign	0.00
R8035:Gm8251	UTSW	1	44061551	missense	possibly damaging	0.51
R8281:Gm8251	UTSW	1	44056538	missense	possibly damaging	0.93
R8523:Gm8251	UTSW	1	44060834	missense	possibly damaging	0.86
R8804:Gm8251	UTSW	1	44056649	missense	probably benign
R8869:Gm8251	UTSW	1	44058265	missense	possibly damaging	0.68
R8891:Gm8251	UTSW	1	44057124	missense	probably benign	0.00
R9010:Gm8251	UTSW	1	44061473	missense	possibly damaging	0.51
R9082:Gm8251	UTSW	1	44060714	missense	unknown
R9097:Gm8251	UTSW	1	44058889	missense	possibly damaging	0.73
R9157:Gm8251	UTSW	1	44057360	missense	probably benign	0.33
R9262:Gm8251	UTSW	1	44057109	missense	possibly damaging	0.73
R9313:Gm8251	UTSW	1	44057360	missense	probably benign	0.33
R9419:Gm8251	UTSW	1	44057775	missense	probably benign	0.03
R9433:Gm8251	UTSW	1	44056508	missense	possibly damaging	0.86
R9485:Gm8251	UTSW	1	44056239	missense	possibly damaging	0.72
R9511:Gm8251	UTSW	1	44059694	missense	probably benign	0.00
R9573:Gm8251	UTSW	1	44056147	nonsense	probably null
R9748:Gm8251	UTSW	1	44056664	missense	possibly damaging	0.91
YA93:Gm8251	UTSW	1	44065085	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTGCTCGCTGAGACTGAACAC -3'
(R):5'- ATGCAAAGCCATGTGCCCTACC -3'

Sequencing Primer
(F):5'- CCCTGTTGTAAGCAATGGTATAG -3'
(R):5'- TACCCTGTGCTACAAAAACCATTG -3'

Posted On

2014-03-28