Incidental Mutation 'R1489:Mia3'
ID 163577
Institutional Source Beutler Lab
Gene Symbol Mia3
Ensembl Gene ENSMUSG00000056050
Gene Name melanoma inhibitory activity 3
Synonyms 9130229H14Rik, B230399H06Rik, LOC385255, A930039G15Rik, Tango
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1489 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 183326725-183369553 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 183338674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 85 (S85P)
Ref Sequence ENSEMBL: ENSMUSP00000104786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109158]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069922
SMART Domains Protein: ENSMUSP00000064801
Gene: ENSMUSG00000056050

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SH3 48 106 2.78e-2 SMART
low complexity region 138 147 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 767 774 N/A INTRINSIC
coiled coil region 1240 1329 N/A INTRINSIC
coiled coil region 1362 1427 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
coiled coil region 1517 1565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109158
AA Change: S85P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104786
Gene: ENSMUSG00000056050
AA Change: S85P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
SCOP:d1fxkc_ 159 274 2e-4 SMART
low complexity region 281 294 N/A INTRINSIC
SCOP:d1fxkc_ 365 463 1e-3 SMART
low complexity region 482 498 N/A INTRINSIC
low complexity region 557 567 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 635 661 N/A INTRINSIC
low complexity region 665 680 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195233
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous null for the large isoform display complete perinatal lethality with impaired collagen secretion, intracellular collagen aggregates, short limbed dwarfism, and arrest of chondrocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Mia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1037:Mia3 UTSW 1 183357354 missense probably benign 0.06
R1997:Mia3 UTSW 1 183344286 missense possibly damaging 0.72
R2261:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2263:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2334:Mia3 UTSW 1 183334402 critical splice donor site probably null
R3417:Mia3 UTSW 1 183362100 missense probably damaging 1.00
R3872:Mia3 UTSW 1 183356998 missense probably benign 0.04
R3943:Mia3 UTSW 1 183358783 missense possibly damaging 0.54
R4398:Mia3 UTSW 1 183330878 missense probably damaging 1.00
R4746:Mia3 UTSW 1 183345220 missense possibly damaging 0.80
R4814:Mia3 UTSW 1 183332830 missense probably damaging 0.98
R4975:Mia3 UTSW 1 183331115 missense probably benign 0.02
R5104:Mia3 UTSW 1 183338132 missense probably damaging 0.98
R5174:Mia3 UTSW 1 183331493 nonsense probably null
R5272:Mia3 UTSW 1 183328270 nonsense probably null
R5445:Mia3 UTSW 1 183336022 missense probably benign 0.06
R5651:Mia3 UTSW 1 183358654 missense probably damaging 1.00
R5852:Mia3 UTSW 1 183332859 missense probably benign 0.01
R6246:Mia3 UTSW 1 183345277 missense probably damaging 0.99
R6565:Mia3 UTSW 1 183331485 missense probably damaging 1.00
R7353:Mia3 UTSW 1 183327392 missense
R7378:Mia3 UTSW 1 183334775 missense probably benign 0.01
R7417:Mia3 UTSW 1 183327653 missense
R7442:Mia3 UTSW 1 183358876 missense probably benign 0.03
R7552:Mia3 UTSW 1 183365695 nonsense probably null
R7959:Mia3 UTSW 1 183344339 missense probably damaging 1.00
R8147:Mia3 UTSW 1 183328207 missense
Predicted Primers PCR Primer
(F):5'- ACATTCAAGCTGGACTGGGGTAGG -3'
(R):5'- TTGCCAACTGAGATAGGCAACAGAG -3'

Sequencing Primer
(F):5'- CTGGACTGGGGTAGGAAGTG -3'
(R):5'- AATCCATCCGAGTGGATGCTG -3'
Posted On 2014-03-28