Mutagenetix > Incidental Mutations

Incidental Mutation 'R1489:Armc3'

163580

Institutional Source

Beutler Lab

Gene Symbol

Armc3

Ensembl Gene

ENSMUSG00000037683

Gene Name

armadillo repeat containing 3

Synonyms

4921513G22Rik

MMRRC Submission

039541-MU

Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R1489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19199302-19310241 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19310047 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 856 (Y856F)

Ref Sequence

ENSEMBL: ENSMUSP00000110287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]

Predicted Effect

probably benign
Transcript: ENSMUST00000049255
AA Change: Y844F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: Y844F

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
low complexity region	544	557	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	620	639	N/A	INTRINSIC
low complexity region	675	696	N/A	INTRINSIC
Pfam:EDR1	723	857	3.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114640
AA Change: Y856F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: Y856F

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
Pfam:EDR1	549	868	1.4e-41	PFAM

Meta Mutation Damage Score

0.1538

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Adam6b	T	A	12: 113,491,451	S629R	probably benign	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
Atxn2l	A	T	7: 126,496,467	S379T	probably damaging	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cap2	A	T	13: 46,609,635	I114F	probably damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Duox2	T	A	2: 122,293,396	M436L	probably benign	Het
Exoc6	T	A	19: 37,597,120	M481K	possibly damaging	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Gm8251	A	G	1: 44,057,790	F1383L	probably benign	Het
Gm8251	T	C	1: 44,061,507	I144V	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Pdzrn4	T	C	15: 92,677,712	L333P	probably benign	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Virma	T	C	4: 11,521,164	V907A	probably damaging	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Armc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Armc3	APN	2	19303858	missense	possibly damaging	0.48
IGL01123:Armc3	APN	2	19201805	missense	possibly damaging	0.87
IGL01142:Armc3	APN	2	19297898	splice site	probably benign
IGL01556:Armc3	APN	2	19269146	missense	probably damaging	1.00
IGL02145:Armc3	APN	2	19296860	missense	possibly damaging	0.81
IGL02145:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02152:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02154:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02243:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02244:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02516:Armc3	APN	2	19300506	missense	possibly damaging	0.94
IGL02691:Armc3	APN	2	19235484	missense	probably damaging	1.00
IGL03151:Armc3	APN	2	19238698	missense	probably damaging	1.00
IGL03190:Armc3	APN	2	19288950	missense	probably damaging	0.99
IGL03288:Armc3	APN	2	19235482	missense	probably damaging	1.00
IGL03338:Armc3	APN	2	19248701	missense	possibly damaging	0.88
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0256:Armc3	UTSW	2	19269216	missense	probably damaging	1.00
R0621:Armc3	UTSW	2	19295393	missense	probably damaging	0.96
R1326:Armc3	UTSW	2	19310124	makesense	probably null
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1990:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1991:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1992:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R2002:Armc3	UTSW	2	19288936	missense	probably benign	0.01
R2095:Armc3	UTSW	2	19288929	missense	possibly damaging	0.65
R2127:Armc3	UTSW	2	19201811	missense	probably damaging	1.00
R2158:Armc3	UTSW	2	19248633	missense	probably damaging	0.99
R2697:Armc3	UTSW	2	19303935	missense	probably damaging	1.00
R3809:Armc3	UTSW	2	19300665	missense	probably damaging	1.00
R3897:Armc3	UTSW	2	19269177	missense	probably damaging	1.00
R4107:Armc3	UTSW	2	19288909	missense	probably benign	0.13
R4326:Armc3	UTSW	2	19300473	missense	probably damaging	0.97
R4464:Armc3	UTSW	2	19248659	missense	probably damaging	0.99
R4702:Armc3	UTSW	2	19309981	missense	probably damaging	1.00
R4923:Armc3	UTSW	2	19292980	critical splice acceptor site	probably null
R5370:Armc3	UTSW	2	19286062	missense	probably benign	0.00
R5518:Armc3	UTSW	2	19297928	missense	probably benign	0.28
R5718:Armc3	UTSW	2	19303799	nonsense	probably null
R5739:Armc3	UTSW	2	19253917	missense	possibly damaging	0.67
R5913:Armc3	UTSW	2	19310047	missense	possibly damaging	0.65
R6211:Armc3	UTSW	2	19296803	critical splice acceptor site	probably null
R6245:Armc3	UTSW	2	19248705	missense	probably damaging	1.00
R6841:Armc3	UTSW	2	19201819	splice site	probably null
R7003:Armc3	UTSW	2	19270028	missense	probably damaging	1.00
R7190:Armc3	UTSW	2	19293136	missense	probably damaging	1.00
R7499:Armc3	UTSW	2	19285979	missense	probably benign	0.03
R7738:Armc3	UTSW	2	19288950	missense	probably damaging	0.99
R7844:Armc3	UTSW	2	19254018	missense	possibly damaging	0.90
R7919:Armc3	UTSW	2	19286095	missense	probably benign	0.00
R8060:Armc3	UTSW	2	19288909	missense	probably benign	0.08
R8111:Armc3	UTSW	2	19296863	missense	probably benign
R8406:Armc3	UTSW	2	19235554	missense	probably damaging	0.98
R8485:Armc3	UTSW	2	19293134	missense	probably damaging	1.00
R8773:Armc3	UTSW	2	19288856	missense	probably benign	0.01
Z1177:Armc3	UTSW	2	19285991	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCTTGCAAATGACCCTGAGCC -3'
(R):5'- GGAGCATCGCATAGTCACATCCAC -3'

Sequencing Primer
(F):5'- GAGCCCCTGGTGTCTTATTC -3'
(R):5'- CACATCCACAGTTTATTTCTACACAG -3'

Posted On

2014-03-28