Incidental Mutation 'R1489:Armc3'
ID163580
Institutional Source Beutler Lab
Gene Symbol Armc3
Ensembl Gene ENSMUSG00000037683
Gene Namearmadillo repeat containing 3
Synonyms4921513G22Rik
MMRRC Submission 039541-MU
Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location19199302-19310241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19310047 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 856 (Y856F)
Ref Sequence ENSEMBL: ENSMUSP00000110287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]
Predicted Effect probably benign
Transcript: ENSMUST00000049255
AA Change: Y844F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: Y844F

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
low complexity region 544 557 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 675 696 N/A INTRINSIC
Pfam:EDR1 723 857 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114640
AA Change: Y856F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: Y856F

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
Pfam:EDR1 549 868 1.4e-41 PFAM
Meta Mutation Damage Score 0.1538 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Armc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Armc3 APN 2 19303858 missense possibly damaging 0.48
IGL01123:Armc3 APN 2 19201805 missense possibly damaging 0.87
IGL01142:Armc3 APN 2 19297898 splice site probably benign
IGL01556:Armc3 APN 2 19269146 missense probably damaging 1.00
IGL02145:Armc3 APN 2 19296860 missense possibly damaging 0.81
IGL02145:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02152:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02154:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02243:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02244:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02516:Armc3 APN 2 19300506 missense possibly damaging 0.94
IGL02691:Armc3 APN 2 19235484 missense probably damaging 1.00
IGL03151:Armc3 APN 2 19238698 missense probably damaging 1.00
IGL03190:Armc3 APN 2 19288950 missense probably damaging 0.99
IGL03288:Armc3 APN 2 19235482 missense probably damaging 1.00
IGL03338:Armc3 APN 2 19248701 missense possibly damaging 0.88
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0256:Armc3 UTSW 2 19269216 missense probably damaging 1.00
R0621:Armc3 UTSW 2 19295393 missense probably damaging 0.96
R1326:Armc3 UTSW 2 19310124 makesense probably null
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1990:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1991:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1992:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R2002:Armc3 UTSW 2 19288936 missense probably benign 0.01
R2095:Armc3 UTSW 2 19288929 missense possibly damaging 0.65
R2127:Armc3 UTSW 2 19201811 missense probably damaging 1.00
R2158:Armc3 UTSW 2 19248633 missense probably damaging 0.99
R2697:Armc3 UTSW 2 19303935 missense probably damaging 1.00
R3809:Armc3 UTSW 2 19300665 missense probably damaging 1.00
R3897:Armc3 UTSW 2 19269177 missense probably damaging 1.00
R4107:Armc3 UTSW 2 19288909 missense probably benign 0.13
R4326:Armc3 UTSW 2 19300473 missense probably damaging 0.97
R4464:Armc3 UTSW 2 19248659 missense probably damaging 0.99
R4702:Armc3 UTSW 2 19309981 missense probably damaging 1.00
R4923:Armc3 UTSW 2 19292980 critical splice acceptor site probably null
R5370:Armc3 UTSW 2 19286062 missense probably benign 0.00
R5518:Armc3 UTSW 2 19297928 missense probably benign 0.28
R5718:Armc3 UTSW 2 19303799 nonsense probably null
R5739:Armc3 UTSW 2 19253917 missense possibly damaging 0.67
R5913:Armc3 UTSW 2 19310047 missense possibly damaging 0.65
R6211:Armc3 UTSW 2 19296803 critical splice acceptor site probably null
R6245:Armc3 UTSW 2 19248705 missense probably damaging 1.00
R6841:Armc3 UTSW 2 19201819 splice site probably null
R7003:Armc3 UTSW 2 19270028 missense probably damaging 1.00
R7190:Armc3 UTSW 2 19293136 missense probably damaging 1.00
R7499:Armc3 UTSW 2 19285979 missense probably benign 0.03
R7738:Armc3 UTSW 2 19288950 missense probably damaging 0.99
R7844:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R7927:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R8060:Armc3 UTSW 2 19288909 missense probably benign 0.08
Z1177:Armc3 UTSW 2 19285991 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTTGCAAATGACCCTGAGCC -3'
(R):5'- GGAGCATCGCATAGTCACATCCAC -3'

Sequencing Primer
(F):5'- GAGCCCCTGGTGTCTTATTC -3'
(R):5'- CACATCCACAGTTTATTTCTACACAG -3'
Posted On2014-03-28