Incidental Mutation 'R1489:Fbxw2'
ID 163581
Institutional Source Beutler Lab
Gene Symbol Fbxw2
Ensembl Gene ENSMUSG00000035949
Gene Name F-box and WD-40 domain protein 2
Synonyms MD6, FBW2, Fwd2
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1489 (G1)
Quality Score 217
Status Validated
Chromosome 2
Chromosomal Location 34804514-34826311 bp(-) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCCCCC to GCCCCCCCC at 34812817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028220] [ENSMUST00000091020] [ENSMUST00000113075] [ENSMUST00000113077] [ENSMUST00000113078] [ENSMUST00000113080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028220
SMART Domains Protein: ENSMUSP00000028220
Gene: ENSMUSG00000035949

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 174 4.48e-2 SMART
WD40 177 212 6.19e-1 SMART
WD40 215 254 4.44e-6 SMART
WD40 257 305 4.95e0 SMART
WD40 311 351 6.6e1 SMART
Blast:WD40 409 451 6e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000091020
SMART Domains Protein: ENSMUSP00000088541
Gene: ENSMUSG00000035949

DomainStartEndE-ValueType
WD40 8 45 4.48e-2 SMART
WD40 48 83 6.19e-1 SMART
WD40 86 125 4.44e-6 SMART
WD40 128 176 4.95e0 SMART
WD40 182 222 6.6e1 SMART
Blast:WD40 280 322 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113075
SMART Domains Protein: ENSMUSP00000108698
Gene: ENSMUSG00000035949

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 174 4.48e-2 SMART
WD40 177 212 6.19e-1 SMART
WD40 215 254 4.44e-6 SMART
WD40 257 305 4.95e0 SMART
WD40 311 351 6.6e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113077
SMART Domains Protein: ENSMUSP00000108700
Gene: ENSMUSG00000035949

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 189 1.03e0 SMART
WD40 192 240 4.95e0 SMART
WD40 246 286 6.6e1 SMART
Blast:WD40 344 386 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113078
SMART Domains Protein: ENSMUSP00000108701
Gene: ENSMUSG00000035949

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 174 4.48e-2 SMART
WD40 177 212 6.19e-1 SMART
WD40 215 254 4.44e-6 SMART
WD40 257 305 4.95e0 SMART
WD40 311 351 6.6e1 SMART
Blast:WD40 409 451 6e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113080
SMART Domains Protein: ENSMUSP00000108703
Gene: ENSMUSG00000035949

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 174 4.48e-2 SMART
WD40 177 212 6.19e-1 SMART
WD40 215 254 4.44e-6 SMART
WD40 257 305 4.95e0 SMART
WD40 311 351 6.6e1 SMART
Blast:WD40 409 451 6e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156130
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] F-box proteins are an expanding family of eukaryotic proteins characterized by an approximately 40 amino acid motif, the F box. Some F-box proteins have been shown to be critical for the ubiquitin-mediated degradation of cellular regulatory proteins. In fact, F-box proteins are one of the four subunits of ubiquitin protein ligases, called SCFs. SCF ligases bring ubiquitin conjugating enzymes to substrates that are specifically recruited by the different F-box proteins. Mammalian F-box proteins are classified into three groups based on the presence of either WD-40 repeats, leucine-rich repeats, or the presence or absence of other protein-protein interacting domains. This gene encodes the second identified member of the F-box gene family and contains multiple WD-40 repeats. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Fbxw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Fbxw2 APN 2 34812949 missense probably benign 0.38
IGL00498:Fbxw2 APN 2 34805941 missense probably damaging 1.00
IGL01359:Fbxw2 APN 2 34822750 missense probably benign 0.07
IGL01770:Fbxw2 APN 2 34811026 missense possibly damaging 0.56
IGL01794:Fbxw2 APN 2 34811119 splice site probably benign
IGL01934:Fbxw2 APN 2 34822606 missense probably damaging 0.99
IGL02444:Fbxw2 APN 2 34805781 missense probably benign 0.09
IGL02948:Fbxw2 APN 2 34805711 makesense probably null
IGL03209:Fbxw2 APN 2 34822663 missense probably damaging 1.00
silkpurse UTSW 2 34812813 critical splice donor site probably null
R0597:Fbxw2 UTSW 2 34811020 missense probably damaging 0.99
R0636:Fbxw2 UTSW 2 34822847 nonsense probably null
R1920:Fbxw2 UTSW 2 34822764 missense probably damaging 1.00
R3177:Fbxw2 UTSW 2 34822750 missense probably benign 0.07
R3277:Fbxw2 UTSW 2 34822750 missense probably benign 0.07
R6194:Fbxw2 UTSW 2 34807404 missense probably damaging 1.00
R6236:Fbxw2 UTSW 2 34822833 missense probably damaging 1.00
R6258:Fbxw2 UTSW 2 34812813 critical splice donor site probably null
R7382:Fbxw2 UTSW 2 34807302 missense probably benign 0.01
R7636:Fbxw2 UTSW 2 34812944 missense probably benign 0.00
R8361:Fbxw2 UTSW 2 34807414 missense possibly damaging 0.90
R8841:Fbxw2 UTSW 2 34822832 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTCAGTGAACCACCTTGTGCC -3'
(R):5'- TCTGCAAAGCTGTGGGATGTAAGC -3'

Sequencing Primer
(F):5'- TCCTTCCAGCATACATAAAGAGTG -3'
(R):5'- GCACAGGGCAGTGTGTTTAC -3'
Posted On 2014-03-28