Incidental Mutation 'R1489:Fmn1'
ID163583
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113365212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 419 (V419E)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: V419E
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: V419E

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: V419E
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: V419E

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110954
Predicted Effect unknown
Transcript: ENSMUST00000161731
AA Change: V419E
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: V419E

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Meta Mutation Damage Score 0.2758 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- TATGGCCCAGAGACCCAAACTGAG -3'
(R):5'- ACCATGCCAAGAGCTGTTGGAAC -3'

Sequencing Primer
(F):5'- GAGTTTATCCCAAAAGCTGACTTCC -3'
(R):5'- TGTGGGGAATCAGGACCTACC -3'
Posted On2014-03-28